MCAT ®

Power PrACTiCe
Blank page
 MCAT ®

Power PrACTiCe

NE W YOR K
Copyright © 2016 LearningExpress.

All rights reserved under International and Pan-American Copyright Conventions.

Published in the United States by LearningExpress, New York.

Cataloging-in-Publication Data is on file with the Library of Congress.

Printed in the United States of America

9 8 7 6 5 4 3 2 1

ISBN 978-1-61103-040-2

For more information on LearningExpress, other LearningExpress products, or bulk sales,

please write to us at:
80 Broad Street
4th Floor
New York, NY 10004
 CoNTeNTS

CHAPTer 1 About the MCAT® Exam 1

CHAPTer 2 The LearningExpress Test Preparation System 5

CHAPTer 3 MCAT® Exam Practice Test 1 21

Part 1: Biological and Biochemical Foundations of Living Systems 27
Part 2: Chemical and Physical Foundations of Biological Systems 48
Part 3: Psychological, Social, and Biological Foundations of Behavior 67
Part 4: Critical Analysis and Reasoning Skills 80

CHAPTer 4 MCAT® Exam Practice Test 2 139

Part 1: Biological and Biochemical Foundations of Living Systems 145
Part 2: Chemical and Physical Foundations of Biological Systems 162
Part 3: Psychological, Social, and Biological Foundations of Behavior 177
Part 4: Critical Analysis and Reasoning Skills 188

v
Blank page
 1
c h a p t e r

About the
MCAt® eXAM

T he Medical College Admission Test® (MCAT®) is designed to measure your ability to think critically
and solve problems, and assess your knowledge base in a variety of core topic areas that are important
to the study and field of medicine. If you’re interested in attending medical school, you’ll almost cer-
tainly have to take the MCAT® exam—and in this ultra-competitive environment you’ll certainly want to get
your best possible score.
The MCAT® exam has undergone a major overhaul in 2015, but don’t worry—you’ve made a wise decision
by getting this book! You’ll get a complete overview of what the new MCAT® exam is like and everything you
need to do between now and test day—from how to register to what to bring and everything in between—as
well as test practice that’s modeled on the official exam. Use MCAT® Power Practice as part of your MCAT®
study plan, and you’ll be well on your way to succeeding on test day and one step closer to achieving your goal
of getting into medical school!

1
 –A B O U T T HE M C AT ® E X A M –

medical school. If you’re a prospective transfer

the MCAt ® exam:
student or advanced standing applicant, you
What to expect
should contact the schools to which you’re
applying for application guidelines.
The MCAT® exam is a multiple-choice test that’s
n Non-AMCAS® participating institutions: Your
divided into four main test sections:
MCAT® exam score can be sent to another appli-
cation service or directly to a specific school,
n Chemical and Physical Foundations of Biological
either electronically or via mail. Please visit the
Systems
AAMC website for additional information.
n Psychological, Social, and Biological Foundations
of Behavior
Your score on the MCAT® exam is typically valid for
n Biological and Biochemical Foundations of Liv-
2–3 years, but this varies by institution. Please contact
ing Systems
the medical school(s) you plan on applying to for
n Critical Analysis and Reasoning Skills
their score acceptance policies.
We’ll explore each test section in depth later in this
chapter, so you’ll know exactly what to expect and so
Registering for the MCAT ® Exam
If you’re interested in earning a professional health
you can prepare to get your best possible scores.
degree, chances are you’ll need to submit an MCAT®
exam score as part of your school application.
How the MCAT ® Exam Is Scored
In order to register for the MCAT® exam, you’ll
Your official MCAT® exam score will be a sum total
need to create an AAMC account and obtain an
of your scores on each of the four test sections. You
AAMC ID, username, and password. Visit the official
will receive a score between 118 and 132 for each sec-
AAMC website to create your account—and read and
tion, and your total score will range from 472 to 528.
follow all of the directions carefully. This will also
Good news—there’s no penalty for guessing—so when
allow you to access additional MCAT®-related infor-
you encounter challenging questions make sure you
mation and services.
give them a shot, eliminating choices you know aren’t
Once you create your account, you’ll be able to
correct in an effort to boost your chances of guessing
view a list of testing locations and schedules and reg-
correctly.
ister for an exam online through the AAMC’s MCAT
After completing the MCAT® exam, you can
Scheduling and Registration System. The AAMC rec-
view your score report on the official Association of
ommends that you register at least 60 days prior to
American Medical Colleges (AAMC) website (www.
your preferred test date.
aamc.org) approximately one month after your test
For a complete list of registration and schedul-
date.
ing options and associated fees—including fee assis-
tance—visit the official AAMC website (www.aamc.
n AMCAS® participating institutions: Your scores
org). You’ll also find helpful information on accom-
will be released automatically to the American
modated testing options if you have a disability or
College Application Service (AMCAS®), so if
medical condition.
you’re a prospective first-year student no addi-
tional action is required by you to include your
scores as part of your online application to

2
 –A BO U T T HE M C AT ® E X A M –

the MCAt ® exam— Psychological, Social, and Biological

test overview Foundations of Behavior

As previously mentioned, the MCAT® exam is a mul- n Total number of questions: 59

tiple-choice test that’s divided into four main ° 10 passage-based question sets (4–6 questions
sections: per set)
° 15 independent questions (not passage based)
n Chemical and Physical Foundations of Biological n Total time: 95 minutes
Systems
n Psychological, Social, and Biological Foundations This section of the exam includes questions that
of Behavior assess your knowledge of core psychological (consis-
n Biological and Biochemical Foundations of Liv- tent with DSM-5), social, and biological concepts,
ing Systems along with your reasoning and scientific inquiry abil-
n Critical Analysis and Reasoning Skills ities. The questions you’ll find in this section are
based on college-level concepts in biology, psychol-
The total exam time is 6 hours and 15 minutes, and ogy, and sociology.
the total “seated” time is 7 hours and 33 minutes—
this includes the examinee agreement, optional tuto- Biological and Biochemical
rial, scheduled breaks between exam sections, and the Foundations of Living Systems
void question and satisfaction survey at the end of
the exam. (Please note that the exam includes a num- n Total number of questions: 59
ber of experimental items that don’t count towards ° 10 passage-based question sets (4–6 questions
your score). per set)
Let’s look at each test section in a little more ° 15 independent questions (not passage based)
depth. n Total time: 95 minutes

Chemical and Physical Foundations of This section of the exam includes questions that
Biological Systems assess your knowledge of core biological and bio-
chemical concepts, along with your reasoning and
n Total number of questions: 59 scientific inquiry abilities. The questions you’ll find in
° 10 passage-based question sets (4–6 questions this section are based on college-level concepts in
per set) biology, biochemistry, and general and organic
° 15 independent questions (not passage based) chemistry.
n Total time: 95 minutes
Critical Analysis and Reasoning Skills
This section of the exam includes questions that
assess your knowledge of core chemical and physical n Total number of questions: 53
science concepts, along with your reasoning and sci- ° 9 passage-based question sets (5–7 questions
entific inquiry abilities. The questions you’ll find in per set)
this section are based on college-level concepts in n Total time: 90 minutes
biology, biochemistry, general and organic chemistry,
and physics.

3
 –A B O U T T HE M C AT ® E X A M –

This section of the exam includes questions that current, government-issued ID that includes your
assess your ability to think critically, comprehend, signature and photo.
assess, analyze, and reason through a variety of writ- ❑ Dress comfortably: Dress in comfortable layers
ten material, which spans a wide array of academic so you can adjust to varying room temperature,
disciplines across the humanities and social sciences. and stay relaxed throughout the exam.
❑ Listen: On exam day, the test center staff will
review all of the directions, rules, and procedures
test Day Checklist for taking the MCAT® exam. Make sure you listen
carefully to everything you’re told. Failure to fol-
There’s nothing worse than studying hard and pre- low the rules may have serious consequences.
paring for an important exam like the MCAT®, only ❑ The night before: Make sure you get plenty of
to have a small test day detail trip you up! Review the rest the night before the exam, and have a good,
following list carefully and make sure you’re pre- nutritious breakfast in the morning. Resist the
pared. Also be sure to visit the official AAMC website urge to have an all-night, sugar-fueled cram ses-
for all the information you need to know between sion. This will not put you in your best test-tak-
now and test day. ing shape!
❑ What not to bring: Leave the following at home
❑ Date and time: Make sure you know the precise on test day, or be prepared to have them stowed
date and time of your exam. Write it down and away in a secure location:
make yourself a reminder. You certainly don’t ° Food and beverages
want to show up on the wrong day or after your ° A watch or timer
exam has already begun! ° A cell phone or other electronic devices
❑ Address: Make sure you know the precise address ° Hats and scarves
of your test location and the most efficient route
for getting there on time.
❑ Transportation: Are you getting to the test center using this book for
by car? Bus? Train? Walking? Know your plan of MCAt ® exam Success
attack for getting to your test center and make
sure there are no unaccounted for variables (i.e., This book provides concentrated practice to get you
road construction causing traffic delays, etc.) that ready for test day. We recommend that you use it as
can derail your plans. Plan carefully and well part of your overall MCAT® exam study plan, to deter-
ahead of time! mine your strengths and weaknesses in each test sec-
❑ Arrival: This is important—you must report to tion and guide your further study and preparation.
your test center at least 30 minutes prior to the Remember, practice and preparation are the
start of your exam in order to be admitted. This keys to doing well on the MCAT® exam. Use this
extra time is used for the test center staff to verify book to your advantage and make the most of your
your ID and seat assignment, and review and study time between now and test day. Good luck!
implement all required admissions procedures.
❑ Bring your ID: Just as important as being pre-
pared to ace the MCAT® exam, make sure you
bring acceptable ID on test day. This must be a

4
 2 THE
C H A P T E R

LEARNINGEXPRESS
TEST PREPARATION
SYSTEM

I t takes significant preparation to score well on any exam, and MCAT® is no exception. The LearningExpress
Test Preparation System, developed by experts exclusively for LearningExpress, offers a number of strategies
designed to facilitate the development of the skills, disciplines, and attitudes necessary for success.
Preparing for and attaining a passing score on the MCAT® exam requires surmounting an assortment of
obstacles. While some may prove more troublesome than others, all of them carry the potential to hinder your
performance and negatively affect your scores. Here are some examples:

n lack of familiarity with the exam format

n paralyzing test anxiety
n leaving preparation to the last minute
n not preparing at all

5
 – TH E L E A RNI N G E X P R E S S T E S T P R E PA R AT I O N S Y S T E M –

n failure to develop vital test-taking skills: Step 1. Get information. 1 hour

n effectively pacing through an exam Step 2. Conquer test anxiety. 20 minutes
n using the process of elimination to answer Step 3. Make a plan. 20 minutes
questions accurately Step 4. Learn to manage your time. 10 minutes
n knowing when and how to guess Step 5. Learn to use the process
n mental and/or physical fatigue of elimination. 20 minutes
n test day blunders: Step 6. Reach your peak
n arriving late at the testing facility performance zone. 10 minutes
n taking the exam on an empty stomach Step 7. Make final preparations. 10 minutes
n not accounting for fluctuations in temperature Step 8. Make your
at the testing facility preparations count. 10 minutes
Total 2 hours, 40 minutes
The common thread among these obstacles is
control. While a host of pressing, unanticipated, and We estimate that working through the entire
sometimes unavoidable difficulties may frustrate system will take you approximately three hours. It’s
your preparation, there remain some proven, effec- perfectly okay if you work at a faster or slower pace.
tive strategies for placing yourself in the best possi- It’s up to you to decide whether you should set aside a
ble position on exam day. These strategies can whole afternoon or evening to work through the
significantly improve your level of comfort with the LearningExpress Test Preparation System in one sit-
exam, offering you not only the confidence you’ll ting, or break it up and do just one or two steps a day
need, but also, and perhaps most importantly, a for the next several days.
higher test score.
The LearningExpress Test Preparation System
helps to put you in greater control. Separated into Step 1: Get Information
nine steps, the system heightens your confidence level
by helping you understand both the exam and your Time to complete: 1 hour
own particular set of test-taking strengths and weak- Activities: Read the introduction to this book.
nesses. It helps you structure a study plan, practice a
number of effective test-taking skills, and avoid men- Knowing more about an exam can often make it
tal and physical fatigue on exam day. Each step is appear less daunting. The first step in the Learning
accompanied by an activity. Express Test Preparation System is to determine
While the following list suggests an approxi- everything you can about the type of information
mate time for the completion of each step, these are you will be expected to know on the MCAT® exam, as
only guidelines for your initial introduction. The reg- well as how your knowledge will be assessed.
ular practice of a number of them may require a more
substantial time commitment. It may also be neces-
sary and helpful to return to one or more of them
throughout the course of your preparation.

6
 – TH E L E A RN I NG E X P R E S S T E S T P R E PA R AT I O N S Y S T E M –

What You Should Find Out they are able to harness to help them perform at their
Knowing the details will help you study efficiently peak. Stop here and answer the questions on the Test
and help you feel a sense of control. Here’s a list of Stress Quiz that follows to determine your level of
things you might want to find out: test anxiety.

n What skills are tested? Stress Management before the Exam

n How many sections are on the exam? If you feel your level of anxiety is getting the best of
n How many questions are in each section? you in the weeks before the exam, here are things you
n How much time is allotted for each section? can do to bring the level down:
n How is the exam scored, and is there a penalty for
guessing/wrong answers? n Prepare. There’s nothing like knowing what to
n Is the test computerized or will you have an exam expect to put you in control of test anxiety. That’s
booklet? why you’re reading this book. Use it faithfully,
n Will you be given scratch paper to write on? and you will be ready on test day.
n Practice self-confidence. A positive attitude is a
You will find answers to these questions in Chap- great way to combat test anxiety. Stand in front of
ter 1 of this book and on the NCSBN’s MCAT® web- the mirror and say to your reflection, “I’m pre-
site, www.ncsbn.org. pared. I’m confident. I’m going to ace this exam.
I know I can do it.” As soon as negative thoughts
creep in, drown them out with these positive
Step 2: Conquer Test Anxiety affirmations. If you hear them often enough, and
you use the LearningExpress method to study for
Time to complete: 20 minutes MCAT®, they will be true.
Activity: Take the Test Stress Quiz.
n Fight negative messages. Every time someone
talks to you about how hard the exam is or says it’s
Now that you know what’s on the test, the next step is difficult to pass, think about your self-confidence
to address one of the biggest obstacles to success: test messages. If the someone with the negative mes-
anxiety. Test anxiety may not only impair your per- sages is you—you’re telling yourself you don’t do
formance on the exam itself, but it can also keep you well on exams, that you just can’t do this—don’t
from preparing properly. In Step 2, you will learn listen. Repeat self-confidence messages.
stress management techniques that will help you suc-
n Visualize. Visualizing success can help make it
ceed on your exam. Practicing these techniques as happen, and it reminds you of why you’re doing
you work through the activities in this book will help all this work in preparing for the exam. Imagine
them become second nature to you by exam day. yourself in your first day of classes or beginning
the first day of your dream job.
Combating Test Anxiety
n Exercise. Physical activity helps calm your body
A little test anxiety is a good thing. Everyone gets ner- and focus your mind. Besides, being in good
vous before a big exam—and if that nervousness physical shape can actually help you do well
motivates you to prepare thoroughly, so much the on the exam. Go for a run, lift weights, go
better. Many athletes report pregame jitters, which swimming—and exercise regularly.

7
 TEST STRESS QuIz

You need to worry about test anxiety only if it is extreme enough to impair your performance. The following
questionnaire provides a diagnosis of your level of test anxiety. In the blank before each statement, write the
number that most accurately describes your experience.

0 = Never
1 = Once or twice
2 = Sometimes
3 = Often

I have gotten so nervous before an exam that I simply put down the books and didn’t study for it.
I have experienced disabling physical symptoms such as vomiting and severe headaches because I was
nervous about an exam.
I have simply not showed up for an exam because I was scared to take it.
I have experienced dizziness and disorientation while taking an exam.
I have had trouble filling in the little circles because my hands were shaking too hard.
I have failed an exam because I was too nervous to complete it.
Total: Add up the numbers in the blanks.

Your Test Stress Score

Here are the steps you should take, depending on your score. If you scored:

n Below 3, your level of test anxiety is nothing to worry about; it’s probably just enough to give you that
extra edge.
n Between 3 and 6, your test anxiety may be enough to impair your performance, and you should practice
the stress-management techniques in this section to try to bring your test anxiety down to manageable
levels.
n Above 6, your level of test anxiety is a serious concern. In addition to practicing the stress management
techniques listed in this section, you may want to seek additional, personal help. Call your community
college and ask for the academic counselor or ask the counselor at your nursing school. Tell the coun-
selor that you have a level of test anxiety that sometimes keeps you from being able to take the exam.
The counselor may be willing to help you or may suggest someone else you should talk to.

8
 – TH E L E A RN I NG E X P R E S S T E S T P R E PA R AT I O N S Y S T E M –

Stress Management on Test Day n Take a mental break. Everyone loses concentra-
There are several ways you can bring down your level tion once in a while during a long exam. It’s nor-
of test stress and anxiety on test day. They’ll work best mal, so you shouldn’t worry about it. Instead,
if you practice them in the weeks before the exam, so accept what has happened. Say to yourself, “Hey, I
you know which ones work best for you. lost it there for a minute. My brain is taking a
break.” Close your eyes and do some deep breath-
n Breathe deeply. Take a deep breath in while you ing for a few seconds. Then go back to work.
count to five. Hold it for a count of one, and then
let it out on a count of five. Repeat several times. Try these techniques ahead of time and see
n Move your body. Try rolling your head in a circle. whether they work for you!
Rotate your shoulders. Shake your hands from
the wrist.
n Visualize again. Think of the place where you are Step 3: Make a Plan
most relaxed: lying on the beach in the sun, walk-
ing through the park, or wherever relaxes you. Time to complete: 20 minutes
Now, close your eyes and imagine you’re actually Activity: Construct a study plan.
there. If you practice in advance, you will find
that you need only a few seconds of this exercise There is no substitute for careful preparation and
to experience a significant increase in your sense practice over time. So the most important thing you
of relaxation and well-being. can do to better prepare yourself for your exam is to
create a study plan or schedule and then follow it.
When anxiety threatens to overwhelm you dur- This will help you avoid cramming at the last minute,
ing the test, there are still things you can do to man- which is an ineffective study technique that will only
age your stress level: add to your anxiety.
Once you make your plan, make a commit-
n Repeat your self-confidence messages. You ment to follow it. Set aside at least 30 minutes every
should have them memorized by now. Say them day for studying and practice. This will do more
quietly to yourself, and believe them! good than two hours crammed into a Saturday. If
n Visualize one more time. This time, visualize you have months before the test, you’re lucky. Don’t
yourself moving smoothly and quickly through put off your studying until the week before. Start
the exam, answering every question correctly, and now. Even 10 minutes on weekdays, with half an
finishing just before time is up. Like most visual- hour or more on weekends, can make a big differ-
ization techniques, this one works best if you’ve ence in your score.
practiced it ahead of time.
n Find an easy question. Skim over the questions
until you find an easy one, and then answer it.
Getting even one question answered correctly
gets you into the test-taking groove.

9
 – TH E L E A RNI N G E X P R E S S T E S T P R E PA R AT I O N S Y S T E M –

Step 4: Learn to Step 5: Learn to use

Manage Your Time the Process of Elimination

Time to complete: 10 minutes to read, many hours Time to complete: 20 minutes

of practice Activity: Complete worksheet on the process of
Activities: Practice these strategies as you take the elimination.
sample exams.
After time management, the next most important tool
Steps 4, 5, and 6 of the LearningExpress Test Prepara- for taking control of your test is using the process of
tion System put you in charge of your MCAT® expe- elimination wisely. It’s standard test-taking wisdom
rience by showing you test-taking strategies that that you should always read all the answer choices
work. Practice these strategies as you take the practice before choosing your answer. This helps you find the
exams in this book and online. Then, you will be right answer by eliminating wrong answer choices.
ready to use them on test day. Consider the following question. Although it is not
First, you will take control of your time on the type of question you will see on MCAT®, the men-
MCAT®. Start by understanding the format of the tal process that you use will be the same.
test. Refer to Chapter 1 to review this information; in
particular, make sure you understand the way the Sentence 6: I would like to be considered for
computerized adaptive testing (CAT) works. the assistant manager position in your com-
You will want to practice using your time wisely pany my previous work experience is a good
on the practice tests, while trying to avoid making match for the job requirements posted.
mistakes while working quickly. Which correction should be made to
sentence 6?
n Listen carefully to directions. By the time you a. Insert Although before I.
get to the test, you should know how it works. But b. Insert a question mark after company.
listen carefully in case something has changed. c. Insert a semicolon and however before my.
n Pace yourself. Glance at your watch every few d. Insert a period after company and capitalize
minutes to ensure that you are not taking much my.
more than one to two minutes on each question. e. No corrections are necessary.
n Keep moving. Don’t spend too much time on
one question. If you don’t know the answer, skip If you happen to know that sentence 6 is a run-on
the question and move on. Mark the question for sentence, and you know how to correct it, you don’t
review and come back to it later, if possible. need to use the process of elimination. But let’s
n Don’t rush. You should keep moving, but rushing assume that, like some people, you don’t. So, you look
won’t help. Try to keep calm and work methodi- at the answer choices. Although sure doesn’t sound
cally and quickly. like a good choice, because it would change the mean-
ing of the sentence. So, you eliminate choice a, and
now you only have four answer choices to deal with.

10
 – TH E L E A RN I NG E X P R E S S T E S T P R E PA R AT I O N S Y S T E M –

Write a on your note board with an X through or It’s good to have a system for marking good,
beside it. Move on to the other answer choices. bad, and maybe answers. We recommend using this
If you know that the first part of the sentence one:
does not ask a question, you can eliminate choice b as X = bad
a possible answer. Write b on your note board with an = good
X through or beside it. Choice c, inserting a semico- ? = maybe
lon, could create a pause in an otherwise long sen-
tence, but inserting the word however might not be If you don’t like these marks, devise your own system.
correct. If you’re not sure whether this answer is cor- Just make sure you do it long before exam day—while
rect, write c on your note board with a question mark you’re working through the practice tests in this book
beside it, meaning “well, maybe.” and online—so you won’t have to worry about it dur-
Choice d would separate a very long sentence ing the exam.
into two shorter sentences, and it would not change Even when you think you’re absolutely clueless
the meaning. It could work, so write d on your note about a question, you can use the process of elimina-
board with a check mark beside it, meaning “good tion to get rid of one answer choice. By doing so,
answer.” Choice e means that the sentence is fine like you’re better prepared to make an educated guess.
it is and doesn’t need any changes. The sentence could Often, the process of elimination allows you to get
make sense as it is, but it is definitely long. Is this the down to only two possible right answers. Neverthe-
best way to write the sentence? If you’re not sure, less, as explained in Chapter 1, rapid guessing is a
write e on your note board with a question mark strategy that should be avoided in the MCAT®. It will
beside it. result in the computer program giving candidates
Now, your note board looks like this: easier items, which you may also get wrong if you are
X a. guessing and running short on time.
X b. Try using your powers of elimination on the
? c. following questions. The answer explanations show
d. one possible way you might use the process to arrive
? e. at the right answer.

You’ve got just one check mark, for a good

answer, d. If you’re pressed for time, you should sim-
ply select choice d. If you’ve got the time to be extra
careful, you could compare your check mark answer
to your question mark answers to make sure that it’s
better. (It is: Sentence 6 is a run-on, and should be
separated into two shorter, complete sentences.)

11
 – TH E L E A RNI N G E X P R E S S T E S T P R E PA R AT I O N S Y S T E M –

Physical and mental fatigue can significantly hinder

Step 6: Reach Your
your ability to perform not only as you prepare, but
Peak Performance zone
also on the day of the exam. Poor diet choices can
hinder you, as well. Drastic changes to your existing
Time to complete: 10 minutes to read, weeks to
daily routine may cause a disruption too great to be
complete!
helpful, but modest, calculated alterations in your
Activity: Complete the Physical Preparation
level of physical activity, the quality of your diet, and
Checklist.
the amount and regularity of your rest can enhance
your studies and your performance on the exam.

uSING THE PROCESS Of ELIMINATION

Use the process of elimination to answer the following questions.

1. Ilsa is as old as Meghan will be in five years. 3. Smoking tobacco has been linked to
The difference between Ed’s age and Meghan’s a. increased risk of stroke and heart attack.
age is twice the difference between Ilsa’s age b. all forms of respiratory disease.
and Meghan’s age. Ed is 29. How old is Ilsa? c. increasing mortality rates over the past
a. 4 10 years.
b. 10 d. juvenile delinquency.
c. 19
d. 24 4. Which of the following words is spelled
correctly?
2. “All drivers of commercial vehicles must carry a. incorrigible
a valid commercial driver’s license whenever b. outragous
operating a commercial vehicle.” c. domestickated
According to this sentence, which of the d. understandible
following people need NOT carry a
commercial driver’s license?
a. a truck driver idling his engine while waiting
to be directed to a loading dock
b. a bus operator backing her bus out of the
way of another bus in the bus lot
c. a taxi driver driving his personal car to the
grocery store
d. a limousine driver taking the limousine to
her home after dropping off her last
passenger of the evening

12
 uSING THE PROCESS Of ELIMINATION (continued)

Answers
Here are the answers, as well as some suggestions as to how you might have used the process of elimination
to find them.

1. d. You should have eliminated choice a right off 3. a. You could eliminate choice b simply because
the bat. Ilsa can’t be four years old if Meghan of the presence of the word all. Such abso-
is going to be Ilsa’s age in five years. The lutes hardly ever appear in correct answer
best way to eliminate other answer choices is choices. Choice c looks attractive until you
to try plugging them into the information think a little about what you know—aren’t
given in the problem. For instance, for fewer people smoking these days, rather than
choice b, if Ilsa is 10, then Meghan must be more? So how could smoking be responsible
5. The difference between their ages is 5. for a higher mortality rate? (If you didn’t know
The difference between Ed’s age, 29, and that mortality rate means the rate at which
Meghan’s age, 5, is 24. Is 24 two times 5? people die, you might keep this choice as a
No. Then choice b is wrong. You could elimi- possibility, but you would still be able to
nate choice c in the same way and be left eliminate two answers and have only two to
with choice d. choose from.) And choice d is plain silly, so
2. c. Note the word not in the question, and go you could eliminate that one, too. You are
through the answers one by one. Is the truck left with the correct choice, a.
driver in choice a “operating a commercial 4. a. How you used the process of elimination
vehicle”? Yes, idling counts as “operating,” here depends on which words you recog-
so he needs to have a commercial driver’s nized as being spelled incorrectly. If you
license. Likewise, the bus operator in choice knew that the correct spellings were outra-
b is operating a commercial vehicle; the geous, domesticated, and understandable,
question doesn’t say the operator has to be then you would be home free. Surely you
on the street. The limo driver in choice d is knew that at least one of those words was
operating a commercial vehicle, even if it wrong in the question!
doesn’t have a passenger in it. However, the
driver in choice c is not operating a commer-
cial vehicle, but his own private car.

Exercise circumstances and needs. Whatever its form, try to

If you are already engaged in a regular program of keep it a regular part of your preparation as the exam
physical activity, resist allowing the pressure of the approaches.
approaching exam to alter this routine. If you are not,
and have not been engaged in regular physical activ- Diet
ity, it may be helpful to begin during your prepara- A balanced diet will help you achieve peak perfor-
tions. Speak with someone knowledgeable about such mance. Limit your caffeine and junk food intake as
matters to design a regimen suited to your particular you continue on your preparation journey. Eat plenty

13
 YOuR GuESSING ABILITY

The following are ten really hard questions. You are not supposed to know the answers. Rather, this is an
assessment of your ability to guess when you don’t have a clue. Read each question carefully, as if you were
expected to answer it. If you have any knowledge of the subject, use that knowledge to help you eliminate
wrong answer choices.

1. September 7 is Independence Day in 6. The religious and philosophical doctrine that

a. India. holds that the universe is constantly in a
b. Costa Rica. struggle between good and evil is known as
c. Brazil. a. Pelagianism.
d. Australia. b. Manichaeanism.
c. neo-Hegelianism.
2. Which of the following is the formula for d. Epicureanism.
determining the momentum of an object?
7. The third Chief Justice of the U.S. Supreme
a. p = MV
Court was
b. F = ma
a. John Blair.
c. P = IV
b. William Cushing.
d. E = mc2
c. James Wilson.
d. John Jay.
3. Because of the expansion of the universe, the
stars and other celestial bodies are all moving 8. Which of the following is the poisonous
away from each other. This phenomenon is portion of a daffodil?
known as a. the bulb
a. Newton’s first law. b. the leaves
b. the big bang. c. the stem
c. gravitational collapse. d. the flowers
d. Hubble flow.
9. The winner of the Masters golf tournament in
1953 was
4. American author Gertrude Stein was born in
a. Sam Snead.
a. 1713.
b. Cary Middlecoff.
b. 1830.
c. Arnold Palmer.
c. 1874.
d. Ben Hogan.
d. 1901.
10. The state with the highest per capita personal
5. Which of the following is NOT one of the Five income in 1980 was
Classics attributed to Confucius? a. Alaska.
a. I Ching b. Connecticut.
b. Book of Holiness c. New York.
c. Spring and Autumn Annals d. Texas.
d. Book of History

14
 YOuR GuESSING ABILITY ( continued )

Answers right, you may be a really terrific guesser. If you got

Check your answers against the following correct one or none right, you may be a really bad guesser.
answers. Keep in mind, though, that this is only a small
1. c. sample. You should continue to keep track of your
2. a. guessing ability as you work through the sample
3. d. questions in this book. Circle the numbers of ques-
4. c. tions you guess on as you make your guess; or, if you
5. b. don’t have time while you take the practice tests, go
6. b. back afterward and try to remember which questions
7. b. you guessed at. Remember, on a test with four
8. a. answer choices, your chance of guessing correctly is
9. d. one in four. So keep a separate “guessing” score for
10. a. each exam. How many questions did you guess on?
How many did you get right? If the number you got
How Did You Do? right is at least one-fourth of the number of questions
You may have simply gotten lucky and actually known you guessed on, you are at least an average guesser—
the answer to one or two questions. In addition, your maybe better—and you should always go ahead and
guessing was probably more successful if you were guess on the real exam. If the number you got right
able to use the process of elimination on any of the is significantly lower than one-fourth of the number
questions. Maybe you didn’t know who the third Chief you guessed on, you would be safe in guessing any-
Justice was (question 7), but you knew that John Jay way, but maybe you would feel more comfortable if
was the first. In that case, you would have eliminated you guessed only selectively, when you can eliminate
choice d and, therefore, improved your odds of a wrong answer or at least have a good feeling about
guessing right from one in four to one in three. one of the answer choices.
According to probability, you should get two- Remember, even if you are a play-it-safe person
and-a-half answers correct, so getting either two or with lousy intuition, you are still safe guessing every
three right would be average. If you got four or more time.

of fruits and vegetables, along with lean proteins and important to determine what an adequate amount of
complex carbohydrates. Foods that are high in leci- rest is for you. Determine how much rest you need to
thin (an amino acid), such as fish and beans, are espe- feel at your sharpest and most alert, and make an effort
cially good brain foods. to get that amount regularly as the exam approaches
Your diet is also a matter that is particular to and particularly on the night before the exam.
you, so any major alterations to it should be discussed It may help to record your efforts. What follows
with a person with expert knowledge of nutrition. is a Physical Preparation Checklist for the week prior
to the exam; you may find its use helpful for staying
Rest on track.
For your brain and body to function at optimal levels,
they must have an adequate amount of rest. It is

15
 PHYSICAL PREPARATION CHECKLIST
For the week before the test, record the type and duration of your physical exercise, your food consumption
for each day, and the number of hours you slept.

Exam minus 7 days Exam minus 3 days

Exercise: ______ for ______ minutes Exercise: ______ for ______ minutes
Breakfast: Breakfast:
Lunch: Lunch:
Dinner: Dinner:
Snacks: Snacks:
Sleep: Sleep:

Exam minus 6 days Exam minus 2 days

Exercise: ______ for ______ minutes Exercise: ______ for ______ minutes
Breakfast: Breakfast:
Lunch: Lunch:
Dinner: Dinner:
Snacks: Snacks:
Sleep: Sleep:

Exam minus 5 days Exam minus 1 day

Exercise: ______ for ______ minutes Exercise: ______ for ______ minutes
Breakfast: Breakfast:
Lunch: Lunch:
Dinner: Dinner:
Snacks: Snacks:
Sleep: Sleep:

Exam minus 4 days

Exercise: ______ for ______ minutes
Breakfast:
Lunch:
Dinner:
Snacks:
Sleep:

16
 – TH E L E A RN I NG E X P R E S S T E S T P R E PA R AT I O N S Y S T E M –

Physical Preparation Checklist to get up that morning, and make sure you get up
In the week leading up to the test, you may be so that early every day for a week before the test.
involved with studying (and, unfortunately, stress) that
you neglect to treat your body kindly. The worksheet Gather Your Materials
on the previous page will help you stay on track. Make sure you have all the materials that will be
For each day of the week before the test, write required at the testing facility. Whether it’s an admis-
down what physical exercise you engaged in and for sion ticket, two forms of ID, pencils, pens, calculators,
how long, and what you ate for each meal. Remem- a watch, or any other item that may be necessary,
ber, you’re trying for at least half an hour of exercise make sure you have put it aside. It’s preferable to put
every other day (preferably every day) and a balanced them all aside together.
diet that is light on junk food. These practices are key Arrange your clothes the evening before the
to your body and brain working at their peak. exam. Dress in layers so that you can adjust readily to
the temperature of the exam room.

Step 7: Make final Preparations Fuel Appropriately

Decide on a meal to eat in the time before your exam.
Time to complete: 10 minutes to read; time to com- Taking the exam on an empty stomach is something
plete will vary to avoid, particularly if it is an exam that spans sev-
Activity: Complete the Final Preparations eral hours. Eating poorly and feeling lethargic are also
worksheet. to be avoided. Decide on a meal that will sate your
hunger without adverse effect.
You’re in control of your mind and body; you’re in
charge of test anxiety, your preparation, and your Final Preparations
test-taking strategies. Now, it’s time to take charge of To help get organized, a Final Preparations worksheet
external factors, like the testing site and the materials is included on page 19.
you need to take the test.

Find Out Where the Exam Is and Step 8: Make Your

Make a Trial Run Preparations Count
Make sure you know exactly when and where your
test is being held. Do you know how to get to the Time to complete: 10 minutes, plus test-taking time
exam site? Do you know how long it will take to get Activity: Ace the MCAT®!
there? If not, make a trial run if possible, preferably
on the same day of the week at the same time of day. Fast-forward to test day. You’re ready. You made a
On the Final Preparations worksheet, make note of study plan and followed through. You practiced your
the amount of time it will take you to get to the test test-taking strategies while working through this
site. Plan on arriving at least 30 to 45 minutes early so book. You’re in control of your physical, mental, and
you can get the lay of the land, use the bathroom, and emotional state. You know when and where to show
calm down. Then figure out how early you will have

17
 – TH E L E A RNI N G E X P R E S S T E S T P R E PA R AT I O N S Y S T E M –

up and what to bring with you. In other words, you’re And then do it. Go into the test full of confi-
well prepared! dence, armed with test-taking strategies you’ve prac-
When you’re finished with the test, you will ticed until they’re second nature. You’re in control of
have earned a reward. Plan a celebration. Call up your yourself, your environment, and your performance
friends and plan a party, have a nice dinner with your on the exam. You’re ready to succeed. So do it. And
family, or pick out a movie to see—whatever your look forward to your future as someone who has
heart desires. passed the MCAT®!

18
 fINAL PREPARATIONS

Getting to the exam site:

Exam date: _____________________________________________________________________________________

Location of exam site: ____________________________________________________________________________

Do I know how to get to the exam site? Yes No (If no, make a trial run.)

Time it will take to get to the exam site: ____________________________________________________________

Departure time: _________________________________________________________________________________

Things to Lay Out the Night Before

Clothes I will wear

Sweater/jacket

Photo ID

Four #2 pencils

Other Things to Bring/Remember

19
Blank page
 3 MCAT EXAM ®
c h a p t e r

PRACTICE
TEsT 1

CHAPTER SUMMARY
This is the first of two practice MCAT® exams.

T he exam is organized in four parts:

n
Part 1: Biological and Biochemical Foundations of Living Systems
Part 2: Chemical and Physical Foundations of Biological Systems
Part 3: Psychological, Social, and Biological Foundations of Behavior
n Part 4: Critical Analysis and Reasoning Skills

(Note: you will have access to the Periodic Table of Elements during the exam.)

This practice test is modeled on the content, format, and length of the official MCAT® exam. At the
beginning of each section you’ll find the number of questions and time allotted. We recommend that you take
the test under timed conditions, so you can get an accurate assessment of how you might do on test day, and
determine the pace you’ll need to work at.
Use your results on each section of the exam to determine your strengths and weaknesses, and guide your
study. Good luck!

21
To access online MCAT practice that provides instant scoring and feedback:
• Navigate to your LearningExpress platform and make sure you’re logged in.
• Search for any of the following tests, select your chosen test, and then click “Start Test.”
• MCAT Practice Test 1: Critical Analysis and Reasoning Skills
• MCAT Practice Test 1: Chemical and Physical Foundations of Biological Systems
• MCAT Practice Test 1: Psychological, Social, and Biological Foundations of Behavior
• MCAT Practice Test 1: Biological and Biochemical Foundations of Living Systems
 –L E A RNIN G E X P R E s s A N s W E R s HE E T –

Part 1: Biological and Biochemical Foundations of Living systems

1. a b c d 21. a b c d 41. a b c d
2. a b c d 22. a b c d 42. a b c d
3. a b c d 23. a b c d 43. a b c d
4. a b c d 24. a b c d 44. a b c d
5. a b c d 25. a b c d 45. a b c d
6. a b c d 26. a b c d 46. a b c d
7. a b c d 27. a b c d 47. a b c d
8. a b c d 28. a b c d 48. a b c d
9. a b c d 29. a b c d 49. a b c d
10. a b c d 30. a b c d 50. a b c d
11. a b c d 31. a b c d 51. a b c d
12. a b c d 32. a b c d 52. a b c d
13. a b c d 33. a b c d 53. a b c d
14. a b c d 34. a b c d 54. a b c d
15. a b c d 35. a b c d 55. a b c d
16. a b c d 36. a b c d 56. a b c d
17. a b c d 37. a b c d 57. a b c d
18. a b c d 38. a b c d 58. a b c d
19. a b c d 39. a b c d 59. a b c d
20. a b c d 40. a b c d

Part 2: Chemical and Physical Foundations of Biological systems

1. a b c d 21. a b c d 41. a b c d
2. a b c d 22. a b c d 42. a b c d
3. a b c d 23. a b c d 43. a b c d
4. a b c d 24. a b c d 44. a b c d
5. a b c d 25. a b c d 45. a b c d
6. a b c d 26. a b c d 46. a b c d
7. a b c d 27. a b c d 47. a b c d
8. a b c d 28. a b c d 48. a b c d
9. a b c d 29. a b c d 49. a b c d
10. a b c d 30. a b c d 50. a b c d
11. a b c d 31. a b c d 51. a b c d
12. a b c d 32. a b c d 52. a b c d
13. a b c d 33. a b c d 53. a b c d
14. a b c d 34. a b c d 54. a b c d
15. a b c d 35. a b c d 55. a b c d
16. a b c d 36. a b c d 56. a b c d
17. a b c d 37. a b c d 57. a b c d
18. a b c d 38. a b c d 58. a b c d
19. a b c d 39. a b c d 59. a b c d
20. a b c d 40. a b c d

23
 –L E A RNI N G E X P R E s s A N s W E R s HE E T –

Part 3: Psychological, social, and

Biological Foundations of Behavior
1. a b c d 21. a b c d 41. a b c d
2. a b c d 22. a b c d 42. a b c d
3. a b c d 23. a b c d 43. a b c d
4. a b c d 24. a b c d 44. a b c d
5. a b c d 25. a b c d 45. a b c d
6. a b c d 26. a b c d 46. a b c d
7. a b c d 27. a b c d 47. a b c d
8. a b c d 28. a b c d 48. a b c d
9. a b c d 29. a b c d 49. a b c d
10. a b c d 30. a b c d 50. a b c d
11. a b c d 31. a b c d 51. a b c d
12. a b c d 32. a b c d 52. a b c d
13. a b c d 33. a b c d 53. a b c d
14. a b c d 34. a b c d 54. a b c d
15. a b c d 35. a b c d 55. a b c d
16. a b c d 36. a b c d 56. a b c d
17. a b c d 37. a b c d 57. a b c d
18. a b c d 38. a b c d 58. a b c d
19. a b c d 39. a b c d 59. a b c d
20. a b c d 40. a b c d

Part 4: Critical Analysis and Reasoning skills

1. a b c d 19. a b c d 37. a b c d
2. a b c d 20. a b c d 38. a b c d
3. a b c d 21. a b c d 39. a b c d
4. a b c d 22. a b c d 40. a b c d
5. a b c d 23. a b c d 41. a b c d
6. a b c d 24. a b c d 42. a b c d
7. a b c d 25. a b c d 43. a b c d
8. a b c d 26. a b c d 44. a b c d
9. a b c d 27. a b c d 45. a b c d
10. a b c d 28. a b c d 46. a b c d
11. a b c d 29. a b c d 47. a b c d
12. a b c d 30. a b c d 48. a b c d
13. a b c d 31. a b c d 49. a b c d
14. a b c d 32. a b c d 50. a b c d
15. a b c d 33. a b c d 51. a b c d
16. a b c d 34. a b c d 52. a b c d
17. a b c d 35. a b c d 53. a b c d
18. a b c d 36. a b c d

24
 –M C AT ® E X A M P R A C T I C E T Es T 1 –

IA VIIIA
1
H
Periodic Table 2

IIA IIIA IVA VA VIA VIIA He

3 4 of Elements 5 6 7 8 9 10
Li Be B C N O F Ne
11 12 13 14 15 16 17 18
Na Mg IIIB IVB VB VIB VIIB VII IB IB Al Si P S Cl Ar
19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
K Ca Sc Ti Y Cr Mn Fe Co Ni Cu Zn Ga Ge As Se Br Kr
37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
Rb Sr Y Zr Nb Mo Tc Ru Rh Pd Ag Cd In Sn Sb Te I Xe
55 56 57 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86
Cs Ba *La Hf Ta W Re Os Ir Pt Au Hg Tl Pb Bi Po At Rn
87 88 89 104 105 106 107 108 109 110
Fr Ra +Ac Rf Ha 106 107 108 109 110

*Lanthanide 58 59 60 61 62 63 64 65 66 67 68 69 70 71
*Series Ce Pr Nd Pm Sm Eu Gd Tb Dy Ho Er Tm Yb Lu
+Actinide 90 91 92 93 94 95 96 97 98 99 100 101 102 103

+Series Th Pa U Np Pu Am Cm Bk Cf Es Fm Md No Lr

Legend
H – gas Li – solid Br – liquids Tc – synthetic

Non-Metals Transition Metals Rare Earth Metals Halogens

Alkali Metals Alkali Earth Metals Other Metals Inert Elements

25
 –M C AT ® E X A M P R A C T I C E T E S T 1–

aggregate, and precipitate, among other activities. In

Part 1: Biological and
contrast, endogenous hemoglobin localizes in
Biochemical Foundations
erythrocytes, where the cell membrane and cellular
of Living systems
reduction pathways reduce or prevent these activities.
It has been proposed that the hypertensive effects of
59 Questions
rHb could be due to the protein having too low an
95 Minutes
affinity for oxygen, causing excessive release of
oxygen into the arterioles and vasoconstriction.
Use the following passage to answer questions 1
Alternatively, it has been proposed that NO
through 4.
scavenging by rHb from the vasculature leads to
depletion of NO, an increase in intracellular calcium,
Hospitals and clinics in the United States and around
and muscle constriction. Since the 1980s when
the world face constant shortages in the supply of
researchers started studying rHb, various conjugates
blood for transfusions. One alternative currently
and amino acid substitutions have been tested for the
being explored is to make recombinant human
ability to reduce issues with stability and toxicity.
hemoglobin (rHb). In addition to increasing supply
Through mutagenesis strategies, it has been possible
for transfusions, rHb has a longer shelf life than red
to identify rHb variants with different rates of
blood cells, is compatible with all blood types, and
oxygen binding and release, as well as some that are
poses lower risk of transmitting disease. Despite
not associated with increases in blood pressure or
these advantages, neither rHb products nor
mean arterial pressure (MAP). However, more work
hemoglobin purified from animals has been licensed
is needed to identify variants with reduced loss of
as therapy in the United States, mainly because of
hemin (a protoporphyrin ring containing chelated
reports of hypertension and associated
iron) and globin denaturation. Work is also
cardiovascular and cerebrovascular problems. (A
underway to lower production costs of rHb variants
product called HBOC-201, which is purified from
that are being developed as potential therapeutic
cows, has been approved for human use in South
products.
Africa and Russia.) The toxicity of rHb has been
attributed to the protein’s presence in the plasma,
where it can scavenge nitric oxide (NO), undergo
oxidative reactions that damage tissues, denature,

27
 –M C AT ® E X A M P R A C T I C E T E S T 1–

1. The table summarizes the difference in blood pressure associated with six variants of rHb along with
several parameters in vitro.

rHb ∆MAP k’ NO, Ox P 50 (mm HG) n max k autox

rHb1 27.5 ± 5.6 57 12 1.8 0.043

rHb2 26.4 ± 1.3 57 37 2.7 0.052
rHb3 22.8 ± 3.6 54 2.8 1.5 0.036
rHb4 18.9 ± 3.2 26 3.9 1.7 0.088
rHb5 11.7 ± 1.5 13 3.3 1.4 0.094
rHb6 6.4 ± 0.9 4 5.4 1.6 0.068

Based on the data in the table, which parameter is most likely to be responsible for the increase in MAP
observed for some rHb variants?

a. NO is being scavenged and depleted.

b. Too much oxygen is being released.
c. The affinity for oxygen is too high.
d. rHb is unstable and autoxidation is occurring.

2. In the figure below, the four curves represent Which curve is most similar to the binding
rHb variants harboring point mutations and curve of endogenous hemoglobin, and why?
their oxygen-binding curves. a. The curve for a(L29F)b(WT) because
A Varying P50 by allosteric mutants hemoglobin has maximal affinity for oxygen
at low and high concentrations
α(L29F)
b. The curve for a(V96W)b(WT) because
1.00 ß(WT)
hemoglobin has high affinity for oxygen at
α(V96W) low and high concentrations
Fractional Saturation (Y)

0.80 ß(WT) c. The curve for a(L29F/V96W)b(N108K)

because hemoglobin has low affinity for
oxygen at low concentrations and high
0.60 affinity for oxygen at high concentrations
d. The curve for a(V96W)b(N108K) because
hemoglobin has low affinity for oxygen at
0.40
α(V96W) low and high concentrations
ß(N108K)
0.20
α(L29F/V96W)
ß(N108K)

0.00
0 20 40 60 80 100
P02 mm Hg

28
 –M C AT ® E X A M P R A C T I C E T E S T 1–

3. Engineering a cellular rHBOC involves recom- 8. How are the plasma membranes of mamma-
binant DNA technology. What is necessary to lian and bacterial cells similar?
make recombinant hemoglobin? a. They typically contain cholesterol.
a. Expression of hemoglobin protein in b. They have negatively charged lipids on their
bacteria surfaces.
b. Knowing the sequence of the hemoglobin c. They contain lipids that are involved in
gene signal transduction.
c. Knowing the hemoglobin gene’s splice d. They are made up of many different types of
donor and acceptor sites phospholipids.
d. Having the crystal structure of hemoglobin
protein Use the following passage to answer questions 9
through 14.
4. Which condition would NOT be expected to
result in increases in extracellular hemoglobin? Under conditions of cell stress, such as exposure to
a. Liver cirrhosis heat, the weak bonds within a protein can be broken,
b. Blood transfusion leading to protein misfolding and self-association.
c. Inflammatory bowel disease When the concentration of misfolded polypeptides
d. Malaria infection becomes high enough, they can form larger
aggregates that are very stable because strong bonds
5. Which of the following amino acids does NOT occur between the molecules. Many age-related
have an isoelectric point (pI) between 5.5 and diseases, including Alzheimer’s, Parkinson’s, and type
6.0? 2 diabetes, are considered to be the result of protein
a. Alanine aggregates, which can eventually cause tissue death.
b. Glutamic acid Chaperone molecules bind with high affinity to
c. Glycine exposed hydrophobic regions on the surface of
d. Glutamine misfolded polypeptides and reduce aggregation.
However, there is increasing evidence that
6. Which amino acid would most likely be found chaperones do not merely act like sponges that
on the surface of a protein molecule at physio- associate with misfolded polypeptides and prevent
logical pH? them from aggregating. Along with a complex of
a. Isoleucine molecules, chaperones can help misfolded substrates
b. Lysine unfold and are thus also called unfoldases. Once the
c. Alanine substrates are completely unfolded, they can then
d. Proline spontaneously refold into their native conformation.
Although chaperones can act on different types of
7. Which of the following statements about ter- proteins, they unfold them with varying degrees of
penes is NOT true? efficiency. For example, one of the major families of
a. They are a type of terpenoid. chaperones, which are highly conserved from
b. They all contain double bonds. bacteria to eukaryotes, is called GroEL/GroES.
c. They are all made up of 5-carbon units. Compared with other chaperones, GroEL/GroES can
d. They all contain oxygen. rapidly convert misfolded rhodanese (rho), a

29
 –M C AT ® E X A M P R A C T I C E T E S T 1–

mitochondrial enzyme involved in detoxifying 9. The graph below shows the concentration of
cyanide, into its unfolded form. However, it is rhodanese (Rho) that is refolded into its native
unclear in general whether a vast excess of native, confirmation in the presence (solid shapes) or
properly folded proteins could compete with absence (open shapes) of an excess concentra-
misfolded substrates for binding to chaperones. tion of native protein, called MDH. Rhodanese
Indeed, native proteins are present in a cell at a much was also incubated with the chaperone GroEL/
higher concentrations relative to misfolded species. GroES (LS, ELS) (top four curves) or without
Furthermore, if chaperones bind inappropriately to (bottom two curves) and with ATP (top two
substrates that they are not able to completely curves) or without (bottom four curves).
unfold, the chaperone molecules may not dissociate
rapidly from the partially unfolded species and their 160
Rho+MDH+LS+ATP Rho+ELS+ATP
activity could get stalled. Another area of question is Rho+MDH+LS Rho+ELS

Refolded rhodanese (nM)

the role of ATP in the unfolding and refolding of Rho+MDH Rho
120
polypeptide substrates. When GroEL/GroES is
bound to substrate, ATP hydrolysis leads to
conformational changes in GroEL and the release of 80
GroES from the complex. One model is that ATP is
not required for the binding of chaperones to
misfolded polypeptides but that, at least for some 40

chaperones, ATP hydrolysis is required for the release

of the unfolded polypeptide from the chaperone 0
complex so it can refold in solution. 0 15 30 45 60
Time (min)

Based on the data presented in the graph, how

does native MDH affect the refolding of rhoda-
nese by the chaperone molecules?

a. The refolding is not affected because the

chaperones bind MDH and Rho
simultaneously.
b. The refolding rate is reduced but the yield of
refolding is not changed.
c. The refolding does not occur because MDH
stalls the chaperones.
d. The refolding yield is reduced because MDH
depletes ATP.

30
 –M C AT ® E X A M P R A C T I C E T E S T 1–

10. Which of the following is NOT a chaperone 14. According to the proposed pathway for the
molecule? action of GroEL/GroES, a single GroEL com-
a. Heat-shock protein (Hsp) 70 plex has two subunits consisting of heptameric
b. SecB rings and each ring binds an ATP molecule.
c. GroEL/GroES How many ADP molecules would be produced
d. PI3K when the complex releases an unfolded
polypeptide?
11. Which of the following statements is true a. 6
about the activity of chaperones? b. 7
a. They can act iteratively on many misfolded c. 12
substrates, one after the other. d. 14
b. They change the chemical composition of
misfolded substrates. 15. The digestive enzyme chymotrypsin hydrolyzes
c. They must remain bound to unfolded nitrophenyl trimethylacetate in a two-step
substrates until they have completely reaction. The initial reaction rate, V0, is
recovered their native conformation. 5 × 10–6 M/sec, and the KM for the reaction is
d. They require ATP to break apart protein 5.6 × 10–7. The rate of enzyme-product com-
aggregates and unfold misfolded plex formation is 0.37/sec, and the rate of
polypeptides. product release is 1.3 × 10–4/sec. The total
concentration of chymotrypsin is 2 × 10–5 M.
12. What types of bonds within a protein are likely What is the maximum rate of the reaction?
to be disrupted upon exposure to heat? a. 2.6 × 10–9 M/sec
a. covalent bonds b. 4.8 × 10–5 M/sec
b. disulfide bonds c. 1.3 × 10–9 M/sec
c. hydrogen bonds d. 9.5 × 10–6 M/sec
d. carbon bonds
Use the following passage to answer questions 16
13. Which of these agents does NOT typically through 18.
denature proteins?
a. Urea In the 1950s, doctors demonstrated that
b. High pH methotrexate (MTX) could cause regression of
c. Alcohol metastatic gestational choriocarcinoma, a highly fatal
d. HEPES cancer of the reproductive tract, paving the way to
the first chemotherapeutic drug that shrinks solid
cancer. Now MTX is used in the treatment of
numerous cancers, including breast, lung,
osteosarcoma, and leukemia. The original
breakthrough arose from the observation that
rapidly dividing cells such as tumor cells require
folate to make thymine; experts thus reasoned that

31
 –M C AT ® E X A M P R A C T I C E T E S T 1–

folate inhibitors could reduce the progression of several conformations of the enzyme. However,
cancer. MTX is a competitive inhibitor of studies have suggested that MTX acts not only by
dihydrofolate reductase (DHFR). By binding to the reducing the level of folic acid; the drug could also
enzyme, MTX reduces its ability to convert directly block the enzyme thymidylate synthase that
dihydrofolate to folic acid, which is a step in a converts the product of folic acid back to
cellular pathway that is necessary for producing dihydrofolate and as a byproduct generates thymine
thymine. The association between MTX and DHFR (in its deoxyribonucleoside 5'-phosphate form,
has been shown to involve a complex process and dTMP) from its precursor.

PANEL A MTX GLU1 4 × 10–7 M

2,400 MTX GLU1 3 × 10–7 M

1/V

MTX GLU1 2 × 10–7 M

1,800
MTX GLU1 1 × 10–7 M

NO INHIBITOR
1,200

500

0 0.005 0.015 0.025

1/S

Journal of Biological Chemistry. 1985;260(17):9720–9726. Reprinted with permission.

16. The graph shows a double-reciprocal plot of 17. What is the difference between a competitve
the rates of inhibition of MTX at different con- and uncompetitive inhibitor of a substrate?
centrations on thymidylate synthase activity. a. A competitive inhibitor does not bind to the
enzyme’s active site, whereas an
Based on the plot, what type of inhibition does
uncompetitive inhibitor binds the enzyme.
MTX exert on thymidylate synthase?
b. A competitive inhibitor binds near the
a. Competitive enzyme’s active site, whereas an
b. Uncompetitive uncompetitive inhibitor does not bind the
c. Mixed (competitive and uncompetitive) enzyme.
d. Irreversible c. A competitive inhibitor binds the enzyme’s
active site, whereas an uncompetitive
inhibitor binds outside the enzyme’s active
site when the enzyme is bound to substrate.
d. A competitive inhibitor binds the enzyme’s
active site, whereas an uncompetitive
inhibitor outside the enzyme’s active site
when the enzyme is not bound to substrate.

32
 –M C AT ® E X A M P R A C T I C E T E S T 1–

18. Based on the KD values in the following table, This protein-DNA linkage has previously been
which form of DHFR binds to MTX with the detected only in mutants such as rad50S, in which
highest affinity? break repair is impeded and DSBs accumulate. In the
budding yeast Saccharomyces cerevisiae, the DSB
DHFR variant 1 KD = 2.2 nM
distribution in a rad50S mutant is markedly different
DHFR variant 2 KD = 9.5 nM from that in wild-type (RAD50) meiosis, and it was
DHFR variant 3 KD = 25 nM
suggested that this might also be true for other
organisms. Researchers have shown that linkages
DHFR variant 4 KD = 3 × 10–8 M
between Rec12 and DNA can actually be detected in
a. Variant 1 Sc. pombe rad50(+) cells, which are proficient for
b. Variant 2 DSB repair. In fact, genome-wide microarray analysis
c. Variant 3 of Rec12-DNA reveals indistinguishable meiotic DSB
d. Variant 4 distributions in rad50(+) and rad50S strains of Sc.
pombe, unlike in Sa. cerevisiae. These results confirm
19. Which of the following modifications would earlier findings describing the occurrence of widely
have the greatest likelihood of improving the spaced DSBs primarily in large intergenic regions of
yield of polymerase chain reaction (PCR) DNA and demonstrate the relevance and usefulness
product? of fission yeast studies employing rad50S. The
a. Increasing the concentration of magnesium researchers have proposed that the differential
(Mg2+) to 1 mM behavior of rad50S strains reflects a major difference
b. Reducing the number of cycles in DSB regulation between the two species—
c. Increasing the concentration of dGTPs and specifically, the requirement for the Rad50-
dCTPs containing complex for DSB formation in budding
d. Reducing the denaturation temperature yeast but not in fission yeast. Use of rad50S and
related mutations may be a useful method for DSB
20. Which chemical modification allows the DNA analysis in other species.
repair system to distinguish between the DNA
template and the newly synthesized strand? 21. After DSB and the action of Rec12 (or Spo11),
a. Alkylation what is the next step that is predicted to occur
b. Methylation in DSB repair during meiosis?
c. Phosphorylation a. The 3' overhang invades the homologous
d. Histone acetylation chromosome.
b. The 5' end and Rec 12 (or Spo 11) invade
Use the following passage to answer questions 21 the homologous chromosome.
through 24. c. The 5' end and Rec 12 (or Spo 11) dissociate,
and the 5' end invades the homologous
The fission yeast Schizosaccharomyces pombe Rec12 chromosome.
protein, which is the homolog of Spo11 in other d. The DSBs are repaired using the
organisms, initiates meiotic recombination by homologous chromosomes as the template.
creating DNA double-strand breaks (DSBs) and
covalently linking to the 5' DNA ends of the break.

33
 –M C AT ® E X A M P R A C T I C E T E S T 1–

22. The figure is a Southern blot showing the DSB pattern of three strains of Sc. pombe, RAD50, rad50S, and
a DSB repair double mutant, swi5∆ rhp57∆, between 0 and 6 hours (h) after the experimental initiation
of meiosis.

rad50+ rad50S swi5Δ rhp57Δ

0 1 2 3 3.5 4 5 6h 0 1 2 3 3.5 4 5 6h 0 2 3 4 4.5 5 6 7h

http://openi.nlm.nih.gov/detailedresult.php?img=2580034_pgen.1000267.g001&rFormat=json&
query=DNA%20repair%20southern%20blot&it=xg,xm&req=4&npos=3.

Based on the image, what is the most appropri- 24. Detection of DNA by Southern blotting relies
ate conclusion about the DSB patterns in these on the use of a nucleotide probe that is
three strains? complementary to sequences in the DNA
a. DSBs are not observed in rad50+. sample. What prevents RNA from being
b. The three strains have similar DSB patterns detected by Southern blotting?
and rates of DSB repair. a. Nucleotide probes do not hybridize to RNA
c. The three strains have similar DSB patterns, molecules.
but the two mutants do not repair the b. RNA cannot be amplified by PCR.
breaks. c. RNA cannot be separated by gel
d. The level of DSB intermediates is higher in electrophoresis.
rad50+ than in the two mutants. d. DNA can be harvested under conditions that
do not allow RNA recovery.
23. Which of the following is NOT a necessary step
in Southern blot analysis? 25. How are centromeres and telomeres similar?
a. Restriction enzyme treatment of DNA a. Both are required for the distribution of
b. Amplification of DNA chromosomes during mitosis.
c. Separation of DNA by gel electrophoresis b. Both are associated with transcriptionally
d. Denaturation of DNA in the gel active DNA.
c. Both are made up of highly repetitive DNA.
d. Both are conserved in prokaryotic and
eukaryotic cells.

34
 –M C AT ® E X A M P R A C T I C E T E S T 1–

Use the following passage to answer questions 26 26. The average FIS, FST, and FIT values,
through 27. representing the extent of deviation from the
Hardy-Weinberg principle, for the five
Family and twin studies have suggested that genetic subpopulations in the study were −0.0121,
factors could be responsible for 50% to 90% of the 0.3366, and 0.3287, respectively. What
variation in bone mineral density (BMD). Therefore, conclusions can be made about Hardy-
a better understanding of these genes could lead to a Weinberg expectations based on these values?
more complete understanding of BMD, as well as a. The SNPs in osteoporosis candidate genes
osteoporosis, which is a condition caused by the loss are consistent with Hardy-Weinberg
of BMD and that leads to bone fragility with aging. expectations both between and within the
Population-based case-control studies have identified five subpopulations.
polymorphisms in many candidate BMD genes. b. The SNPs in osteoporosis candidate genes
These studies have also highlighted genetic variability are consistent with Hardy-Weinberg
between Asian and Caucasian populations in at least expectations between the five
five important osteoporosis candidate genes. To take subpopulations, but the SNPs within the
a more extensive look at the genetic variability, subpopulations differ from Hardy-Weinberg
researchers investigated single nucleotide expectations.
polymorphisms (SNPs) in 81 genes associated with c. The SNPs in osteoporosis candidate genes
osteoporosis by sequencing across exons, splice differ from Hardy-Weinberg expectations
junctions, and promoter regions. They analyzed between the five subpopulations but the
these genes among 24 unrelated Korean individuals SNPs within the subpopulations are
and compared them to previously reported SNPs in consistent with Hardy-Weinberg
Japanese, Chinese, Caucasian, and African expectations.
subpopulations. The researchers identified 942 d. The SNPs in osteoporosis candidate genes
variants, including 888 SNPs, 43 insertion/deletion differ from Hardy-Weinberg expectations
polymorphisms, and 11 microsatellite markers. They both between and within the five
determined whether some of the common SNPs in subpopulations.
these subpopulations agree with or deviate from the
Hardy-Weinberg principle, which states that genetic 27. In the Korean subpopulation, 36% of individu-
variation should remain constant between als are homozygous for a common SNP,
generations in the absence of factors such as natural whereas 48% do not have the SNP. What per-
selection and nonrandom mating. Further studies of centage of individuals in this subpopulation is
osteoporosis could utilize the polymorphisms heterozygous for the SNP?
identified in this study since they may have a. 8
important implications for the selection of highly b. 16
informative SNPs for future association studies. c. 32
d. 42

35
 –M C AT ® E X A M P R A C T I C E T E S T 1–

28. Which of the following is a typical E. coli pro- pathway. However, under conditions of hyperglyce-
moter sequence? (N is a nucleotide spacer mia, the polyol pathway is activated, leading to the
region.) accumulation of sorbitol and a concomitant reduc-
a. [AT-rich region]-N-TTGACA-N-TATATG- tion in NADPH and NAD+. (The activity of sorbitol
N-transcription start site dehydrogenase does not increase to deal with the
b. [GC-rich region]-N-TTGACA-N-TATATG- increased levels of sorbitol.) These changes occur
N-transcription start site primarily in tissues, including the lens, retina, kidney,
c. [AT-rich region]-N-TTGACA-N-TATAAT- and peripheral nerves, which do not depend on insu-
N-transcription start site lin to take up glucose. The increase in sorbitol, which
d. [GC-rich region]-N-TTGACA-N-TATAAT- is not easily cleared from cells, leads to cell swelling
N-transcription start site and changes in membrane permeability, primarily in
the lens. In addition, the drop in NADPH and NAD+
29. In the following reaction, what would be the levels causes an increase in reactive oxygen species
effect of adding more C(s) while maintaining (ROS) and oxidative stress. Together, these changes,
constant pressure? along with downstream enzymes that respond to
changes in the polyol pathway and contribute to oxi-
C(s) + CO2(g) ⇔ 2CO(g) dative stress and inflammation, precipitate diabetic
a. The reaction equilibrium shifts from left to complications such as cataracts, retinopathy, neurop-
right. athy, and atherosclerosis. In the hope of combating
b. The reaction equilibrium shifts from right to some of these complications, researchers have devel-
left. oped a number of ALR inhibitors (ARIs) over the
c. The reaction equilibrium does not change. past several decades. Currently, epalrestat is the only
d. The reaction loses equilibrium. ARI that has been approved for clinical use, and it is
only approved in Japan, China, and India. The
Use the following passage to answer questions 30 majority of ARIs have not been developed into useful
through 35. therapies because of their low efficacy and adverse
side-effect profiles, which is primarily due to their
Changes in the polyol pathway are a leading cause of effects on ALRs that are not involved in the polyol
diabetic complications. The substrate for the pathway; for instance, ALR1 is active against toxic
pathway is glucose, an essential monosaccharide that aldehydes. Consequently, researchers have been
falls into the family known as aldoses because it designing and testing new ARIs derived from a cycli-
contains a carbonyl group at the end of its carbon cal molecule called quinoxaline. To evaluate these
chain. In the first step of the pathway, an aldose derivatives’ efficacy, the researchers have tested their
reductase called ALR2, in the presence of cofactor ability to inhibit ALR2 based on their IC50 values.
NADPH, reduces glucose to sorbitol. Then sorbitol IC50 corresponds to the drug concentration that is
dehydrogenase converts sorbitol to fructose along required to inhibit 50% of the activity of an enzyme.
with the reduction of NAD+. Under nondisease However, it has been proposed that for a drug to
conditions, a low level of glucose enters the polyol effectively prevent and reduce diabetic complica-
pathway because ALR2 has a weak affinity for tions, it may have to suppress oxidative stress as well
glucose; most glucose instead goes into the glycolytic as reduce ALR activity. As a result, researchers are

36
 –M C AT ® E X A M P R A C T I C E T E S T 1–

working to develop drugs that also have anti-oxidative properties. Compounds that exhibit both of these prop-
erties would be pursued for their ability to constitute important new multifunctional ARIs.

OH HO O OH

O HO
OH OH

OH OH HO HO

Glucose Fructose

30. The polyol pathway metabolizes glucose into 33. Based on the provided chemical structure, qui-
fructose. Based on their chemical structures, to noxaline is an analog of what type of
which monosaccharide families do glucose and hydrocarbon?
fructose belong?
a. Glucose is an aldose and fructose is a hexose. N
b. Glucose is an aldose and fructose is a ketose.
c. Glucose is a ketose and fructose is an aldose.
d. They are both aldoses.
N
31. Which of the following monosaccharides is
essential for humans and can be obtained at a. Cyclohexane
high levels from diet? b. Benzene
a. Glucose c. Anthracene
b. Galactose d. Naphthalene
c. Fructose
d. Fucose

32. Which cell type uses insulin to help take up

glucose?
a. Lens
b. Adipose
c. Kidney
d. Nerves

37
 –M C AT ® E X A M P R A C T I C E T E S T 1–

34. Based on the table, which compound derived from quinoxaline would be predicted to be the most effec-
tive treatment for diabetic complications and carries the lowest risk of adverse side effect?

COMPOuNd IC 50 FOR ALR2 IC 50 FOR ALR1

3 0.498 6.9
6 0.065 29.8
8 0.412 24.3
13 0.067 6.4

a. Compound 3 species usually binds to messenger RNAs (mRNAs)

b. Compound 6 that have regions of near-perfect complementarity,
c. Compound 8 which represses translation or, in some cases, leads to
d. Compound 13 cleavage of the mRNa. LncRNAs, on the other hand,
are generally defined as RNA molecules that are
35. To determine if quinoxaline-derived com- longer than 200 nucleotides. They often resemble
pounds are potent antioxidants, researchers mRNA molecules because of features such as being
exposed them to DPPH, which is a free radical capped and polyadenylated, and they are actually
that loses its purple color when it accepts more abundant than protein-coding RNAs in the
hydrogen. Using this assay, what method could cell. Although lncRNAs were originally thought of as
be used to quantitatively measure the antioxi- transcriptional noise or artifacts of cloning, recent
dative activities of the compounds? studies suggest that they play a number of regulatory
a. Spectrophotometry roles in gene expression and in localization of
b. Enzyme digest proteins and subcellular structures; lncRNAs are also
c. Gel electrophoresis small RNA precursors. In the case of both miRNAs
d. Electron microscopy and lncRNAs, changes in expression levels have been
associated with HCC survival and response to
Use the following passage to answer questions 36 treatment. For example, overexpression of an
through 39. lncRNA called HOTTIP may be responsible for
chemoresistance. Decreased expression of a miRNA
Noncoding RNA molecules have the potential to play called miR26 has been associated with shorter
important roles both in the development and survival but also superior response to interferon
treatment of cancer. Of the many classes of therapy for hepatitis C virus (HCV), whereas
noncoding RNA molecules, two types are decreased expression of miR122 has also been linked
dysregulated in hepatocellular carcinoma (HCC) and with poor progression in patients with HCC. The
various other types of cancer: microRNAs (miRNAs) differential expression of noncoding RNA in HCCs
and long noncoding RNAs (lncRNAs). MiRNAs are suggests that these molecules could serve as
short (21 to 23 nucleotides) single-stranded RNAs biomarkers if the differential expression can be
that are processed from longer precursor miRNAs shown more consistently among studies than it has
and that are found in most organisms. This RNA been to date. There is particular need for noninvasive

38
 –M C AT ® E X A M P R A C T I C E T E S T 1–

biomarkers that allow detection of early HCC. 36. How are miRNAs and siRNAs different from
Several properties of RNAs make them attractive each other?
clinical tools, including the fact that they can be a. MiRNAs are generally longer than siRNAs.
detected in patient sera, they are stable, and sensitive b. MiRNAs block translation, whereas siRNAs
detection methods are available, such as microarray degrade mRNAs.
and polymerase chain reaction. On the therapeutic c. MiRNAs are endogenously expressed in
side, noncoding RNAs have become new molecular humans, whereas siRNAs are exogenously
targets for HCC drugs. The leading drug candidate is expressed.
called Miravirsen, and it inhibits miR122, which is d. MiRNAs do not undergo processing in cells,
required for replication of HCV. Miravirsen is whereas siRNAs are processed through the
currently in phase II clinical trials. Another class of Dicer pathway.
noncoding RNAs, called short interfering RNAs
(siRNAs), is also being developed as a potential 37. Which of the following features would
HCC therapeutic. Although siRNAs are not normally lncRNAs NOT be expected to have?
expressed in human cells, the potent ability of these a. 5'-capping
22-nucleotide molecules to bind and degrade b. Acetylation
mRNAs with complementary sequence makes them c. Polyadenylation
highly valuable tools for targeting cellular proteins. d. Splice donor and acceptor sites
Similar to miRNAs, siRNAs can be processed from a
double-stranded RNA molecule by a cellular protein 38. What types of noncoding RNA species would
called Dicer. One siRNA-based treatment for be predicted to have the following sequences
primary as well as metastatic liver cancer destroys the (where Nx represents x number of
RNAs encoding kinesin spindle protein and vascular nucleotides)?
endothelial growth factor. Currently, this drug has
been found to be safe in phase I clinical trials. Sequence 1 uggagugugacaaugguguuug
Furthermore, siRNAs could be developed that target Sequence 2 cccuuccuuuaucccaguggggcccaga
lncRNAs that are critical for the development of cccgcgcaaccaggcggggaggggaggugggc (N3660)
progression of HCC. As more clinical studies are ggauaguuuuuccaccuuugcccgauacaauuu
conducted on these novel drug candidates, several aaaaaaaaaaa
obstacles will need to be overcome. Major challenges a. Sequence 1 is an miRNA; sequence 2 is an
include the off-target effects of short noncoding lncRNA.
RNAs: both miRNA and siRNA species have been b. Sequence 1 is an lncRNA; sequence 2 is an
reported to bind mRNAs with imperfect miRNA.
complementarity and cause their translational c. Sequence 1 is an lncRNA; sequence 2 is an
repression. In addition, the clinical application of siRNA.
noncoding RNAs will require improved chemical d. Both sequences are miRNAs.
formulations that ensure their delivery to
appropriate tissues in the body.

39
 –M C AT ® E X A M P R A C T I C E T E S T 1–

39. Which of the following properties would need complications, particularly ethical concerns and
to be improved to use noncoding RNA as questions about tumor formation and immune
diagnostic markers? rejection after transplantation. In 2006, researchers
a. Stability made a potential breakthrough in stem cell therapy
b. Ability to detect them in sera when they demonstrated that c-Myc, Sox2, Oct4, and
c. Ability to amplify them to improve detection Klf4 could reprogram somatic cells into a state of
sensitivity pluripotency. Nevertheless, the induction of
d. Reliable changes in expression levels in pluripotency is an inefficient process, and the
patients with HCC requirement to overexpress c-Myc and the other
factors similarly raised concerns about tumor
40. Some species of coldwater fish have proteins in formation as a potential adverse side effect. An
their blood that can lower the blood’s freezing alternative source of stem cells is self-renewing cells
point. If the concentration of these so-called that reside in the epithelial lining of skin, stomach,
antifreeze proteins in the blood is 4 × 10–3 mc, intestine, and other tissues and that help replenish
what is the freezing point depression? the tissue after exposure to environmental insults.
a. 0.002 K These cells are referred to as adult stem cells (ASCs),
b. 0.007 K and they are multipotent, meaning that they can
c. 1.15 K differentiate into all of the cell types of their resident
d. 3.16 K tissue. ASCs do not present the same ethical dilemma
as ESCs and FSCs and may solve concerns of
Use the following passage to answer questions 41 immune rejection if autologous transplants are used.
through 44. As a result, much work has been devoted to
characterizing the biomarkers found on the surface
Although common neurological diseases, such as of ASCs to understand and isolate these cell
Alzheimer’s, Parkinson’s, and amyotrophic lateral populations. Yet ASCs still present challenges, such as
sclerosis (ALS), have distinct symptoms and difficulty harvesting, poor proliferation, and limited
molecular mechanisms, they share one important differentiation. One type of ASCs, mesenchymal
feature: they all involve the death of neuronal cells. In stem cells (MSCs), has the advantage of being
the case of Alzheimer’s, cell death occurs in the brain relatively easy to isolate from samples such as the
and is nonspecific, whereas with Parkinson’s and spinal fluid or umbilical cord blood, and they also
ALS, it is limited to dopaminergic neurons and expand well in tissue culture. In addition, it has been
motor neurons, respectively. Nevertheless, because demonstrated that MSCs not only differentiate into
the pathologies of these diseases all lead to the bone, cartilage, and adipocyte cells but could also
destruction of nerve cells, stem cell–based give rise to a variety of other cell types, including
regeneration has the potential to be effective against neurons. Once in the body, the localization of MSCs
all of them. Stem cells are defined by two important could rely on cytokines and growth factors, such as
properties: their potential to proliferate and to platelet-derived growth factor, that mediate cell
differentiate into multiple cell types. They can be migration. In one study, intravenous administration
derived from embryonic tissue (embryonic stem cells of spinal fluid–derived MSCs was found to improve
[ESCs]) and fetal tissue (fetal stem cells [FSCs]). symptoms in patients following a stroke. However,
However, ESCs and FCSs face a number of numerous studies have raised doubt about whether

40
 –M C AT ® E X A M P R A C T I C E T E S T 1–

the beneficial effects of MSCs in the treatment of 42. Which type of stem cell is the best choice for
neurological diseases are due to paracrine effects of the treatment of neurological diseases?
these cells rather than their ability to directly lead to a. ESCs
the regeneration of neuronal cells, which is required b. FSCs
for functional recovery from neuronal diseases. For c. Induced pluripotent stem cells
this reason, adult neural stem cells (NSCs), which d. ASCs
exhibit both paracrine and direct differentiation
effects, are also being pursued in the development of 43. Which of the following characteristics would
clinical therapies. The drawbacks with NSCs, NOT be essential for the validation of MSC
however, are the difficulty of harvesting them from cells in tissue culture?
the unique microenvironment of the subventricular a. They must adhere to the plastic surface of
and subgranular zones in the brain and their less Petri dishes.
robust proliferation capacity. Despite the challenges, b. They must express a specific subset of
researchers have had success isolating very small markers on their surface.
brain samples for the isolation of NSCs. Although c. They must show the capacity to differentiate
studies are in preclinical and early clinical trials, stem into osteoblasts, adipocytes, and
cell–based therapy seems to hold the greatest chrondoblasts.
potential against diseases such as stroke, Parkinson’s, d. They must be dependent on a specific subset
and ALS. Unfortunately, this therapy may not hold of growth factors for proliferation.
great promise for patients with Alzheimer’s because
the widespread neuronal death in the brain makes 44. Which of the following would NOT be a pre-
harvesting cells for NSC difficult and the disease dicted mechanism by which MSCs lead to
process that leads to neuronal cell destruction in the improvements in neurological symptoms in
first place could quickly destroy transplanted cells. patients?
a. Secretion of growth factors
41. What type of cellular protein induces b. Secretion of pluripotency-inducing factors
pluripotency in somatic cells? c. Release of anti-apoptotic factors
a. Cell cycle proteins d. Secretion of cytokines
b. Kinases
c. Transcription factors Use the following passage to answer questions 45
d. Transmembrane proteins through 47.

Compared with their eukaryotic counterparts,

bacteria are small and have simple structures. Their
genomes are a mere 1 to 5 million nucleotides,
compared with the 12 million of yeast and 3 billion
of humans. Despite their diminutive size, a subset of
these organisms can cause devastating disease in
humans, animals, and plants. When a bacterial
infection is suspected in a clinical setting, the Gram
stain is often the first test that is performed, which

41
 –M C AT ® E X A M P R A C T I C E T E S T 1–

allows classification of the bacteria as either Gram- Staphylococcus aureus can be distinguished from
positive or Gram-negative. Gram-positive bacteria, other Staphylococci species because it has coagulase
such as Staphylococci, possess a single membrane and activity, which results in hemolysis of red blood cells
a cell wall that is thick and is composed of cross- on a blood agar plate. These and a panel of other
linked peptidoglycan. Bacteria in this group retain tests are routinely performed in clinical microbiology
the violet dye used in the Gram stain procedure. labs, either by hand or automated machines, to iden-
Gram-negative bacteria, such as Salmonella, possess tify organisms from patient samples.
two membranes that are separated from each other
by a periplasmic space. The cell wall is located in this 45. Which set of test results would lead to the
space in Gram-negative bacteria, and it is thinner positive identification of Staphylococcus aureus
than in Gram-positive bacteria; as a result, Gram- in a patient sample?
negative bacteria cannot retain the violet dye used in a. Gram-positive, cocci-shaped, catalase-
Gram staining. Bacteria can be also be classified positive, coagulase-positive
based on their shape: spheres (cocci), such as b. Gram-positive, cocci-shaped, catalase-
Streptococcus; rods (bacilli), such as E. coli; and spiral negative, coagulase-positive
cells (spirochetes). However, many bacteria have c. Gram-positive, rod-shaped, catalase-
similar shapes within the Gram-positive and Gram- positive, coagulase-positive
negative categories. Another way to distinguish d. Gram-negative, cocci-shaped, catalase-
between different bacteria is based on the proteins on positive, coagulase-positive
the cell surface. Many bacteria have helical flagella on
their surface that they use for propulsion, or pili 46. Based on the image, what types of bacteria
spikes that allow them to adhere to host tissue. There could be depicted?
are also more specific tests. For example, the
Lancefield system groups Streptococci (groups A–H,
K–M, O–V) based on the carbohydrate groups on
their surface, which can be detected using antibody-
based tests. Some tests rely on enzymatic activity. The 2µm

catalase test differentiates aerobic and anaerobic

1 2 3
bacteria because only the former express high levels
http://www.ncbi.nlm.nih.gov/books/NBK26917/.
of the catalase enzyme, which converts hydrogen
peroxide to hydrogen and oxygen. The presence of a. 1, Streptococcus pyogenes; 2, Staphylococcus
catalase can be detected in this test because the aureus; 3, Borrelia burgdorferi
bacteria produce bubbles in the presence of hydrogen b. 1, Escherichia coli; 2, Streptococcus pyogenes;
peroxide. Other enzyme tests involve growing the 3, Borrelia burgdorferi
bacteria on specialized agar plates. For example, c. 1, Escherichia coli; 2, Streptococcus pyogenes;
lactose-fermenting enteric bacteria, including E. coli 3, Treponema pallidum
and Klebsiella, can be identified on MacConkey agar. d. 1, Streptococcus pyogenes; 2, Escherichia coli;
These bacteria ferment the lactose in the agar, caus- 3, Treponema pallidum
ing the pH of the lactose to change and the agar to
undergo an easily perceptible change in color.

42
 –M C AT ® E X A M P R A C T I C E T E S T 1–

47. Based on the image, what type of bacteria could Use the following passage to answer questions 49
have this type of cell membrane and wall? through 52.

Energy homeostasis is tightly controlled by the

central nervous system (CNS), and in particular a
region of the brain called the hypothalamus, in
conjunction with peripheral signals that convey
information to the CNS. When the process becomes
imbalanced, it can lead to metabolic disorders such
as obesity, as well as cardiovascular diseases,
hypertension, stroke, and type 2 diabetes. The
neuronal circuit in the hypothalamus that is most
critical for energy homeostasis is called the
melanocortin system. This system is made up of
three neuronal populations: neurons that express
agouti-related peptide (AgRP) and the neuropeptide
Y (NPY) and neurons that express
proopiomelanocortin, both of which are located in
CYTOSOL the hypothalamic arcuate nucleus, and neurons that
express the melanocortin 4 receptor (MC4R), located
http://www.ncbi.nlm.nih.gov/books/NBK26917/.
in the hypothalamic paraventricular nucleus. POMC
a. Salmonella bongori neurons are anorexigenic because, by activating
b. Escherichia coli MC4R, they reduce food intake and increase energy
c. Bacillus anthracis expenditure. On the other hand, AgRP/NPY neurons
d. Neisseria meningitidis are orexigenic because they antagonize the activity of
POMC. POMC is a large polypeptide hormone that
48. Based on the table, which of the gases would is processed by proteases that cleave in between basic
have the highest concentration in water at 25°C residues to produce nine proteins. Of these proteins,
with the pressure of 1 atm? a-MSH is a well-known anorexigenic molecule that
exerts its effect by binding and activating
GAs k h (atm/M) AT 25°C melanocortin receptors. A number of peripheral
He 2.7 × 103 hormones also regulate the melanocortin neurons,
N2 1.6 × 103 including leptin, insulin, ghrelin, glucocorticoids,
and thyroid hormones. In particular, the leptin
O2 7.8 × 102
hormone, which is produced by adipocytes, has
CO2 29 received a lot of attention for its potential to combat
obesity. Mice that carry two defective variants of the
a. He
gene encoding leptin have abnormal growth, have an
b. N2
unbridled appetite, and become obese. Furthermore,
c. O2
the receptors for leptin, unlike the receptors for
d. CO2
hormones such as insulin, are primarily expressed in

43
 –M C AT ® E X A M P R A C T I C E T E S T 1–

the brain in regions that control eating behavior, 49. What would be the predicted effect of muta-
namely the hypothalamic arcuate nucleus and the tions that disrupt the POMC gene?
hypothalamic paraventricular nucleus. Binding of a. Decreased fat accumulation
leptin to its receptor, Ob-Rb, activates a JAK-STAT b. Increased fat accumulation
signaling pathway that leads to the activation of c. Upregulation of a-MSH
expression of the POMC gene and thus exerts d. Activation of MC4R neurons
anorexigenic effects. Despite the involvement of
leptin in food intake, however, injection of the 50. Between which two amino acids would a
hormone is not associated with weight reduction. POMC protease cleave?
This finding suggests that steps in energy a. Arg-Gln
homeostasis that are downstream of leptin b. Asp-His
expression, as well as other factors, also play key roles c. Arg-Lys
in obesity. The insulin hormone, produced by d. Lys-Glu
b-pancreatic cells, has receptors in many organs,
including the hypothalamus. Similar to leptin, 51. Following binding of leptin to Ob-Rb, what is
insulin signals for the increased production of the next step in the signaling pathway?
POMC; insulin receptors in NPY neurons decrease a. The POMC gene is upregulated.
the production of the orexigenic NPY. Unlike leptin b. The receptor molecules dimerize.
and insulin, ghrelin stimulates orexigenic neurons. c. The intracellular region of the receptor is
Also in contrast to leptin and insulin, this hormone phosphorylated.
produced by endocrine cells in the stomach acts on a d. The STAT signaling molecule is
short time scale and is responsible for rapid feelings phosphorylated.
of sharp hunger. In addition to these and other
hormones, the melanocortin system is regulated by
nutrients such as glucose, lipids, and amino acids.
The interplay of neuroendocrine mediators has
evolved to control food intake and metabolism, to
prevent starvation, and to avoid harmful obesity.

44
 –M C AT ® E X A M P R A C T I C E T E S T 1–

52. Which hormones follow the patterns shown in 53. Based on the graph, which of the following is
the graphs below? NOT true about the role of natural killer (NK)
cells in controlling viral infection?
Breakfast Lunch Dinner
800

700 Production NK-cell- T-cell-

of IFN-α, mediated mediated
600 IFN-β, TNF-α, killing of killing of
and IL-12 infected cells infected cells
500

400

300

200

600

500
Virus titer
400

300
1 2 3 4 5 6 7 8 9 10
200
Time after viral infection (days)
100

0 a. They are activated in response to interferon

6 A.M. 12 noon 6 P.M. 12 midnight
molecules and some cytokines.
a. The top graph is insulin; the bottom graph is b. They are part of the adaptive immune
leptin. response to viruses, along with T-cells.
b. The top graph is leptin; the bottom graph is c. Their levels decline as T-cells start to be
insulin. produced.
c. The top graph is insulin; the bottom graph is d. They help control virus replication in the
ghrelin. initial days of infection.
d. The top graph is ghrelin; the bottom graph
is insulin. 54. Which class of immunoglobulin is the first to
be made after B-cell activation?
a. IgA
b. IgE
c. IgG
d. IgM

45
 –M C AT ® E X A M P R A C T I C E T E S T 1–

Use the following passage to answer questions 55 fatty acids. Many drugs have been modified with
through 57. these types of lipids to improve bioavailability. For
example, a study of the HIV drug didanosine
The typical route of absorption of orally conjugated the compound to triglycerides. Even
administered drugs is via intestinal cells called though lipid modifications have been found to
enterocytes. Drugs are transported across these cells adversely affect activity for other drugs, the study
and in most cases then diffuse into the portal vein, found that triglyceride derivatives of didanosine did
which brings blood from the intestines to the liver. not become significantly more toxic to peripheral
Absorption through this route, however, involves blood mononuclear cells in culture, based on CD50
first-pass metabolism through the liver, which values, which is the concentration of drug at which
significantly reduces the concentration of the drug half of the cells die. In addition, the derivates were
that makes it into systemic blood. An alternative similar to unmodified didanosine in their effective
route that avoids this effect is for drugs to enter dose, or ED50 values, which in this case is the
lymphatic vessels after transport across enterocytes. concentration of drug that inhibits viral reverse
There is a dense layer of blood and lymphatic vessels transcriptase activity. In addition to boosting better
underlying enterocytes of the gastrointestinal tract, bioavailability, HIV drugs that have increased
yet because of the higher flow rate of portal blood, lymphatic transport could be especially effective
the majority of compounds take this route. However, against this virus because it has been suggested that
there are drug properties that can encourage the gut lymphatic system is critical in the
lymphatic drug uptake. For example, the diffusion of development of infection. Several other viruses are
drug molecules across the blood vessel endothelium also thought to spread through the lymphatic
can get blocked, and as a result intestinal lymph network, such as hepatitis B, hepatitis C, and severe
transport is favored because lymphatic capillaries are acute respiratory syndrome. This network is also the
more permeable than blood capillaries. In addition, primary route for transport of B and T cells, as well
the association of drug compounds with lipoproteins as metastasis of solid tumors. Thus,
in enterocytes not only facilitates their transport immunomodulatory compounds and anticancer
through these cells but also preferentially releases drugs could also be effective if they were absorbed
them into lymphatic vessels because they are too big lymphatically.
to diffuse into blood vessels. As a result, lipophilic
drugs, such as cyclosporine, halofantrine, and 55. Which of these lipids would be expected to
testosterone derivatives, have lymphatic transport, most improve lymphatic uptake in the gut
which studies have shown contribute to their when conjugated to a drug compound?
bioavailability. In contrast, hydrophilic drugs, such as a. choline
caffeine and salicylic acid, are primarily taken up by b. glycerol
blood vessels. The type of lipid determines the c. palmitic acid
lipophilicity of the compound: fatty acid chains with d. phosphatidylcholine
more than 14 carbons are more lipophilic than
shorter chains, and unsaturated fatty acids are more
likely to undergo lymphatic transport than saturated

46
 –M C AT ® E X A M P R A C T I C E T E S T 1–

56. What drug compound property would NOT be 59. The FDA recently approved a laboratory test
expected to improve its bioavailability? for determining a patient’s risk of developing
a. Molecular weight increase acute kidney injury (AKI). In this test,
b. Molecular weight decrease increases in urinary levels of tissue inhibitor of
c. Colloidal material design metalloproteinase 2 (TIMP-2) and insulin-like
d. Hydrophilicity growth factor binding protein 7 (IGFBP-7) are
predictive of AKI. Based on the plot, where
57. Based on the data in the table, which com- light gray bars represent patients with AKI
pound would be expected to be the most toxic? based on Kidney Disease: Improving Global
Outcomes classification and the dark gray bars
COMPOuNd Ed 50 (mM) Cd 50 (mM) represent patients without AKI, what can be
concluded about this new test’s usefulness in
didanosine 3.2 11.0
patients pre-surgery (1), immediately after sur-
didanosine-derivative 1 1.5 9.4
gery (2), 4 hours after surgery (3), and the first
didanosine-derivative 2 7.2 51.2 postoperative morning (4)?
didanosine-derivative 3 26.2 12.7
14
a. didanosine
12
b. didanosine-derivative 1
[TIMP-2]*[IGFBP-7]

c. didanosine-derivative 2 10

d. didanosine-derivative 3 8

6
58. In what way are the molecular motor proteins
kinesin and dynein similar to each other? 4

a. Both are associated with microtubules. 2

b. Both are involved in fast axonal transport.

0
c. Both are inhibited by the ATP analog 1 2 3 4
AMP-PNP.
Critical Care. 2015;19:3. Reprinted with permission.
d. Both conduct primarily retrograde axonal
transport. a. It can determine the risk of AKI before and
after surgery.
b. It can predict preoperatively who will
develop AKI on the first postoperative day.
c. It can distinguish between patients with and
without AKI on the first postoperative day.
d. It is not a precise predictor of AKI risk either
before or after surgery.

47
 –M C AT ® E X A M P R A C T I C E T E S T 1–

majority of currently sequenced thermophilic and

Part 2: Chemical and Physical
hyperthermophilic archaeal genomes. Denaturation
Foundations of
of Ssh10b by urea, a chaotropic agent, was tested at
Biological systems
five different pH values (3, 5, 7, 9, and 10) and eight
different NaCl salt concentrations (0 M [black
59 Questions
squares], 0.01 M [open squares], 0.02 M [black
95 Minutes
circles], 0.05 M [open circles], 0.1 M [black
1. The average total lung capacity of an adult triangles], 0.2 [open triangles], 0.5 M [inverted black
human male is 6.0 L of air at a body triangles], and 1 M [inverted open triangles]). The
temperature of 310 K and atmospheric results are shown in Figure 1.
pressure. Given that air is 78.1% nitrogen, how
1.0 (a) pH3
many nitrogen molecules would be present in
the lungs of an adult human male when filled 0.5
to capacity with air?
a. 8.26 × 1022 molecules N2 0.0
b. 1.11 × 1023 molecules N2 1.0 (b) pH5
c. 1.42 × 1023 molecules N2
d. 1.84 × 1023 molecules N2 0.5

2. What is the pH of a solution of 0.805 M 0.0

Fraction Unfolded

benzoic acid and 0.0800 M potassium benzoate 1.0 (c) pH7

if its Ka value is 6.28 × 10–5?
0.5
a. 3.20
b. 4.50 0.0
c. 5.30
1.0 (d) pH9
d. 6.10
0.5
3. When 5.00 mL of ethanol (MW = 46.1 g/mol)
was burned in an excess of oxygen gas (MW = 0.0
32.0 g/mol), 1.10 mL of water (MW = 18.0 g/
1.0 (e) pH10
mol) was collected. The density of ethanol is
0.789 g/mL, and the density of water is 1.00 g/ 0.5
mL. What is the percent yield for this reaction?
a. 18.8% 0.0
b. 24.3% 0 2 4 6 8 10
c. 35.7% [Urea] (M)
d. 71.4%
Figure 1. The effects of pH and salt concentration on
urea-induced Ssh10b unfolding at 25° C.
Questions 4 through 7 are based on the following
Yong-Jin Mao, Xiang-Rong Sheng, Xian-Ming Pan, © 2007 Mao
passage. et al; licensee BioMed Central Ltd. This image is available from
http://www.biomedcentral.com/1471-2091/8/28.

The homodimeric DNA-binding protein Ssh10b,

from Sulfolobus shibattae, is conserved in the

48
 –M C AT ® E X A M P R A C T I C E T E S T 1–

The structure of urea is shown in Figure 2. 6. The pKa values for four buffers at room
temperature are shown in the table.
O
C BuFFER pK a
H2N NH2
Glycine-HCl 2.4
Figure 2. The structure of urea. Sodium acetate 4.8
HEPES 7.6
4. What is the most likely mode of protein Ammonium acetate 4.76, 9.24
denaturation by urea, based on its structure?
a. Disruption of crosslink bonds between Which buffer would be most appropriate for
monomers obtaining the denaturation curves displayed in
b. Breakage of disulfide bonds within the Figure 1, panel c?
tertiary structure of the protein a. Glycine-HCl
c. Disruption of the hydrogen-bonding b. Sodium acetate
network in the protein c. HEPES
d. Promotion of peptide bond hydrolysis to d. Ammonium acetate
break the amino acid chain
7. In the presence of salt, what effect does pH
5. Based on the results obtained, what effect do have on the unfolding free energy (∆G) of
the tested salt concentrations have on protein Ssh10b?
stability? a. The unfolding ∆G increases as pH increases.
a. At low pH, increased salt concentration b. The unfolding ∆G increases as pH decreases.
results in increased protein stability, but at c. The unfolding ∆G increases at low pH and
high pH, protein stability is independent of decreases at high pH.
salt concentration. d. The unfolding ∆G decreases at low pH and
b. At high pH, increased salt concentration increases at high pH.
results in increased protein stability, but at
low pH, protein stability is independent of
salt concentration.
c. At the tested pH, increased salt
concentration consistently decreases protein
stability.
d. At the tested pH, increased salt
concentration consistently increases protein
stability.

49
 –M C AT ® E X A M P R A C T I C E T E S T 1–

Questions 8 through 11 are based on the following 9. As more mass, m, is added to the box, how
information. does the potential energy of the box at the end
of the extended spring change?
A horizontal spring is bolted to a wall on one end a. The potential energy of the box increases as
and is attached to a box on the other end (Figure 1). m increases.
At rest, the distance between the wall and the box is b. The potential energy of the box decreases as
0.5 meters. The box itself has a mass of 1.0 kg, and m increases.
the spring constant is 5.0 N/m. c. The potential energy of the box stays the
same as m increases.
d. The potential energy of the box increases or
decreases based on the rate of change of the
spring constant.
m

10. For the spring system described in Figure 1,

what is the potential energy when the spring is
Figure 1. A box is attached to a horizontal spring. fully extended and no mass m is added?
a. 0.63 J
Several different weights, of mass m, were added to b. 1.4 J
the box to change its overall mass. For each trial, the c. 2.5 J
box was moved 0.75 meters away from the wall, the d. 3.1 J
spring’s full extension. All motion is frictionless.
11. The kinetic energy of the box is increasing.
8. The number of oscillation cycles that the Therefore, the box must be
spring completes in a given time frame is a. moving toward equilibrium.
called the b. moving away from equilibrium.
a. velocity. c. moving to the left.
b. acceleration. d. moving to the right.
c. period.
d. frequency.

50
 –M C AT ® E X A M P R A C T I C E T E S T 1–

Questions 12 through 15 are based on the following information.

A voltaic cell is set up to study the reaction below, with two vessels connected by a salt bridge and wire at 25°C:

–
MnO4 + 3VO2+ + H2O → MnO2 + 6H+ + 3VO+2

The following table provides standard reduction potentials at 25°C for the two relevant half-reactions:

HALF-REACTION sTANdARd REduCTION POTENTIAL (V)

– –
MnO4 + 4H+ + 3e → MnO2 + 2H2O +1.68
+ –
VO 2 + 2H+ + e → VO2+ + H2O +1.00

12. In a voltaic cell like the one described, a O

reduction reaction occurs at
a. the anode. Mn O–
O
b. the cathode.
c. both the anode and the cathode. O
d. neither the anode nor the cathode.
There are four possible resonance structures, with
13. In the reaction described, which element is the single bond on each of the four oxygens, but for
being oxidized over the course of the reaction the purposes of VSEPR shapes, these resonance
of interest? structures are not particularly important. What is
a. H important is that there are no lone pairs on the Mn
b. Mn atom that will influence the shape of the molecule.
c. O There are four ligands on Mn, and there are no lone
d. V pairs on the central atom. Therefore, the shape of the
molecule is tetrahedral. There are no lone pairs on
14. What is the VSEPR shape of the Mn-containing Mn that would cause the square planar shape. This
reactant species? shape is usually observed when there are four ligands
a. Square planar and two lone pairs on the central atom. Linear
b. Tetrahedral configurations most commonly occur in molecules
c. Linear with two ligands on the central atom. And Seesaw
d. Seesaw configurations commonly occur when there are four
ligands and two lone electron pairs on a central
atom. Since there are four ligands and no lone pairs
on Mn in permanganate, this is not the correct
shape.

51
 –M C AT ® E X A M P R A C T I C E T E S T 1–

15. Given that Faraday’s constant is 96,485 C/mol, magnitude on the MS/MS spectrum, for each pep-
what is the value of ∆G° for the reaction of tide of three proteins of interest from the extracts
interest? (Figure 1).
a. –65.7 kJ
ATP Synthase CF1 α
b. –197 kJ 1.0
ATP Synthase CF1 β
c. 127 kJ RuBisCO

d. 382 kJ 0.95

N/(15N+14N)
Questions 16 through 19 are based on the following
0.9
passage.

15
Rt =
0.85
Metabolic labeling of proteins can be used for insight
into their turnover rates. Such labeling was used to
follow the turnover of specific proteins from the 0.8

single-celled green algae Chlamydomonas reinhardtii. 0 5 10 15 20

Time (hr)
To accomplish this labeling for proteins in the algae,
growth medium was prepared with standard Tris- Figure 1. Protein turnovers for the initial 20 hours.
acetate-phosphate (TAP) medium in which nitrogen- Source: Sauer et al. Metabolic labeling with stable isotope nitro-
gen (15N) to follow amino acid and protein turnover of three
containing components of the media had their plastid proteins in Chalamydomonas reinhardtii. Proteome Sci-
nitrogen atoms replaced with 14N, allowing for ence. 2014; 12:14.
normal algal cell growth. By mass spectrometry, it
was determined that 15N was incorporated into 13 16. A feature of algal cells such as Chlamydomonas
amino acids at approximately 98% labeling reinhardtii cells that might increase the
efficiency. The 14N- and 15N-labeled crude algal difficulty of experimental cell lysis is
protein extracts were mixed with detergent-like a. the presence of membrane-bound
sodium dodecyl sulfate and separated by size and organelles.
charge using SDS-PAGE. The 55-kDa SDS-PAGE b. the presence of a chitin-based cell wall.
bands from the crude extracts were digested using c. the presence of a cellulose-based cell wall.
trypsin, and 27 proteins were identified by LC-MS/ d. the absence of a nucleus.
MS. Five of these proteins, present in both the
labeled and unlabeled samples, exhibited peptide 17. What is the difference in mass between a fully
sequence confidence levels higher than 95% and pro- labeled and unlabeled free asparagine amino
tein sequence coverage higher than 25%. After the acid, based on the labeling method described
newly synthesized 15N-labeled free amino acids and in the passage?
proteins reached maximal 15N incorporation, turn- a. 1 amu
over rates were determined after the cells were trans- b. 2 amu
ferred into unlabeled TAP medium. Turnover rates c. 3 amu
were measured in terms of fractional abundance (Rt), d. 4 amu
with 14N and 15N levels quantified using the peak

52
 –M C AT ® E X A M P R A C T I C E T E S T 1–

18. Why would a significant increase in Rt never be 19. During which experimental procedure does
observed in Figure 1? denaturation of the proteins of interest first
a. Rt measures the absolute quantity of labeled occur?
free amino acids and proteins in labeled a. Cell growth in 15N-labeled TAP media
media, so additional labeling will occur from b. SDS-PAGE
media molecules that are already being c. Trypsin digestion
detected. d. LC-MS/MS
b. Rt measures the fraction of total free amino
acids and proteins that are labeled in labeled Questions 20 through 23 are based on the following
media, so additional labeling will occur from passage.
media molecules that are already being
detected. Capillaries are fine, branching blood vessels that con-
c. Rt measures the absolute quantity of labeled nect arteriole and venule vessels (Figure 1; page 54).
free amino acids and proteins after transfer They work as networks called capillary beds and
to the unlabeled media, so no additional allow for fluid, nutrient, and waste exchange between
detection of isotope labels should occur. the blood and body tissues. The porous capillary
d. Rt measures the fraction of total free amino walls allow for diffusion of water and small solutes,
acids and proteins that are labeled after while larger biomolecules like proteins cannot pass
transfer to the unlabeled media, so no through. At the arteriole end, fluid moves from the
additional detection of isotope labels should vessel to the body tissue, while at the venule end,
occur. fluid, gas, and wastes enter the capillary from the
body tissue. In the central portion of the capillary
network, fluid passes equally between the capillary
and body tissues, and general gas, nutrient, and waste
exchange takes place. In particular, fluid exchange is
controlled by hydrostatic and osmotic pressure.

53
 –M C AT ® E X A M P R A C T I C E T E S T 1–

Precapillary
Arteriole sphincters Artery

Smooth muscle
Lymphatic
capillary

Capillaries

Thoroughfare
channel

Metarteriole
Interstitial Venule Vein
space

Small venule

Figure 1.
Scioli et al. Aging and microvasculature. Vascular Cell. 2014;6:19.

20. The gas that diffuses out of the capillaries and 22. If all arterial blood is directed into the capillary
into the interstitial fluid is bed, the flow rate of the blood in the capillaries
a. CO2 should
b. NH3 a. increase, per Dalton’s law.
c. O2 b. decrease, per Dalton’s law.
d. N2 c. increase, per the continuity equation.
d. decrease, per the continuity equation.
21. Based on the fluid movement described in the
passage, the osmotic pressure on the arteriole 23. Which of the following assumptions of
end of the capillary bed is Poiseuille’s equation is true of capillary bed
a. greater than the hydrostatic pressure. blood flow and does not demonstrate the limi-
b. less than the hydrostatic pressure. tations of the equation in this context?
c. equal to the hydrostatic pressure. a. The fluid is Newtonian.
d. bidirectional on the capillary walls. b. The fluid is incompressible.
c. The tube is long and straight.
d. Fluid flow is steady and laminar.

54
 –M C AT ® E X A M P R A C T I C E T E S T 1–

24. Heat transfer due to concerted, collective

movement within fluids is
a. conductive.
b. convective.
c. mechanical.
d. radiative.

25. Pressure-volume (PV) diagrams are widely used to characterize the performance of the intact heart
under various conditions. For a particular cavity of the heart, the point at the bottom right of the loop is
the end-diastolic point where the contraction begins. Moving counterclockwise around the loop, the
opening and closing of the cavity’s valves react to changes in pressure and volume. The upper left curve
of the loop represents the end-systolic point. The PV diagram below was recorded for simultaneous con-
tractions of the left (outer, larger loop) and right (inner, smaller loop) ventricles of the heart.

PV Diagram
200.0
Pressure-Volume LV [mmHg-ml]
p [mmHg]
Pressure-Volume RV [mmHg-ml]

150.0

100.0

50.0

0.0
0.0 25.0 50.0 75.0 100.0 125.0 150.0 175.0 V [ml]

Wildhaber et al. A graphical simulation software for instruction in cardiovascular mechanics physiology.
BioMedical Engineering OnLine. 2011;10:8.

What conclusion can be drawn about the c. The elasticity of the right ventricle is
behavior of the left and right ventricles under significantly lower than normal under the
the tested conditions? conditions tested in the experiment, while
a. The end-systolic volume is higher than the the elasticity of the left ventricle has not
end-diastolic volume for both the left and been affected.
right ventricles during ventricular d. The elasticity of the left ventricle is
contraction. significantly higher than normal under the
b. The contraction of the left ventricle conditions tested in the experiment, while
contributes more than that of the right the elasticity of the right ventricle has not
ventricle to the total amount of work done been affected.
by the ventricles to eject blood.
55
 –M C AT ® E X A M P R A C T I C E T E S T 1–

26. The change in length of an object under linear rRNAs in each reaction and subtracting it from that
thermal expansion is a function of of a background control reaction containing no 2-5A
I. the initial length cofactor. Using this method, Michaelis-Menten
II. the initial temperature curves were created to test the effect of curcumin on
III. the magnitude of change in temperature RNase L activity (Figure 2). With curcumin present,
a. I only the Km did not change, but Vmax decreased.
b. I and II only Finally, the change in intrinsic fluorescence
c. I and III only intensity [(F0-F)/F0] from a 280-nm excitation
d. I, II, and III wavelength at the 340-nm emission wavelength was
measured with increasing curcumin concentrations
Questions 27 through 31 are based on the following in order to test the ability of the molecule to bind
passage. RNase L (Figure 3; page 57). The Kd value for bind-
ing was determined by fitting the curve using the Hill
Ribonuclease L (RNase L) is a key antiviral equation.
endoribonuclease that is induced and activated
25
by virus infection, interferons, or double-stranded
28S and 18S rRNA degraded (pmole/min)

RNA (dsRNA). A cofactor called 2-5A binds to

monomeric RNase L to convert it to an active, 20

dimeric enzyme. When active, dimeric RNase L

degrades single-stranded RNA to eliminate virus and 15
virus-infected cells.
Curcumin, an orange-yellow pigment from the 10
herb c. longa, has been found to have numerous
therapeutic effects. The chemical structure is shown
5
in Figure 1. Its effect on RNase L activity was studied.
The interaction was determined to follow Michaelis-
Menten kinetics. 0
0.0 0.1 0.2 0.3
RNA Concentration (µM)
O O
(–) curcumin
CH3O OCH3
5µM curcumin
10µM curcumin

HO Curcumin OH Figure 2. The effect of curcumin on RNase L activity.

Figure 1. The chemical structure of curcumin.

Reaction mixtures were prepared that contained

purified protein, 2-5A, and 0, 5, or 10 µM curcumin.
RNA degradation was quantified by measuring the
intensity of the residual intact bands of 28S and 18S

56
 –M C AT ® E X A M P R A C T I C E T E S T 1–

1.0 28. Which Lineweaver-Burk plot most resembles

the effect of curcumin (dashed line) on normal
0.8
RNase L activity (solid line)?
a. I/V
(F0 – F)/F0

0.6

0.4

0.2

0.0
0 5 10 15 20
I/[S]
Curcumin (µM) b. I/V

Figure 3. Fluorescence-based binding of curcumin to

RNase L.
Source: Ankush Gupta and Pramod C. Rath, “Curcumin, a
Natural Antioxidant, Acts as a Noncompetitive Inhibitor of
Human RNase L in Presence of Its Cofactor 2-5A in Vitro,”
BioMed Research International, vol. 2014, Article ID 817024, 9
pages, 2014. doi:10.1155/2014/817024.
I/[S]

c. I/V
27. Curcumin, shown in Figure 1, has a character-
istic UV-visible spectral peak around 419 nm.
The structural feature of curcumin that is most
responsible for this UV-visible signal is its
a. anhydride group.
b. hydroxyl groups.
c. spin-spin splitting. I/[S]
d. conjugated π-system. d. The line does not change when inhibitor is
added.

29. Based on the data collected in these

experiments, what is the mode of RNase L
inhibition by curcumin?
a. Competitive inhibition
b. Uncompetitive inhibition
c. Noncompetitive inhibition
d. Irreversible inhibition

57
 –M C AT ® E X A M P R A C T I C E T E S T 1–

30. The most significant contributors to the

intrinsic fluorescence and curcumin-induced
Retina
quenching, measured in Figure 3, are Iris
Cornea
a. tryptophan residues.
Pupil
b. alanine residues. Optic Nerve
Lens
c. cysteine residues.
d. glutamine residues.
Sclera

31. How can the Gibbs free energy of curcumin

Figure 1. The human eye.
binding to RNase L be determined from the
Samantha L. Wilson, Alicia J. El Haj, Ying Yang. Control of scar
data obtained in these experiments? tissue formation in the cornea: Strategies in clinical and corneal
tissue engineering. J Funct Biomater. 2012;3(3):642–687.
a. ∆G = RT ln(Kd)
V
b. ∆G = _________________________
max
[Total RNase L Concentration] 32. What percentage of its refracting power does
[Curcumin Concentration]
_________________________
c. ∆G = Kd 1 + Ki
the cornea lose when submerged in water
d. ∆G = eKd/RT compared to the open air?
n1 – n2
___________
Refracting power = d (in meters)
Questions 32 through 35 are based on the following
a. 13%
passage.
b. 25%
c. 75%
The human eye is the organ that reacts to light. The
d. 87%
outer layer of the eye is called the cornea. The cornea
has a refractive index (n) of 1.38 and a radius of cur-
33. What is the effective focal length, f, for the
vature (R) of 7.8 mm. Air has a refractive index
average eye for an object that is positioned 1.00
of 1.00, while water has a refractive index of 1.33.
meter away in the open air?
The average distance from the cornea to the retina is
1
__ 1 1
17.0 mm. Myopia, or nearsightedness, occurs when f = __ __
d + d
0 i
rays are focused before they reach the retina, while
a. 0.0598 mm
hyperopia, or farsightedness, occurs when light rays
b. 0.598 mm
focus behind the retina rather than directly on it.
c. 1.67 mm
d. 16.7 mm

34. A ray of light passes from the open air into the
cornea at an incident angle of 80.0°. From
Snell’s Law, what is the angle of refraction in
the cornea?
a. 10.0°
b. 44.5°
c. 45.5°
d. 80.0°

58
 –M C AT ® E X A M P R A C T I C E T E S T 1–

35. Based on Figure 1 (page 58) and the informa- Questions 39 through 44 are based on the following
tion in the passage, which of the following is a passage.
possible cause of myopia?
a. There is insufficient optical (refractive) Arginase (RocF) hydrolyzes L-arginine to form
power. L-ornithine and urea [CO(NH2)2]. In general,

b. The eye is too long. arginases have an alkaline pH optimum and require
c. The refractive index of the cornea constantly manganese for activation, but the Helicobacter pylori
fluctuates. is optimally active with cobalt at pH 6. The metal ion
d. There are defects in the retinal ganglia. forms a complex with arginine and promotes the
enzymatic reaction. The arginase from Bacillus
36. Circular dichroism (CD) spectroscopy makes anthracis was purified for a structural and functional
use of the differential absorption of left and investigation.
right circularly polarized light to study the The B. anthracis rocF gene was cloned and
secondary structure of proteins. Circularly expressed in E. coli. After purification, RocF was
polarized light occurs when tested for arginase activity with several different
a. the oscillation of the electric field occurs in metals. Arginase activity of extracts containing the
one plane. expressed protein was measured at pH 6.3 and pH 9
b. the electric field vector rotates in a plane in the presence of a wide array of metals, each
perpendicular to the propagation direction individually tested at 5 mM, or using deionized water
with increasing angular velocity. in a “no metal” control. Spectrophotometric readings
c. the electric field vector rotates in a plane were taken at 515 nm after 24 hours (Figure 1;
perpendicular to the propagation direction page 60). A viable cell arginase assay was performed
with constant angular velocity. by growing B. anthracis in the absence or presence of
d. the electric field vector rotates in a plane various metal concentrations, and cells were har-
perpendicular to the propagation direction vested and assayed directly for arginase activity at its
with decreasing angular velocity. optimal pH (Figure 2). Finally, amino acid sequence
alignment studies showed particularly high sequence
37. Saponification is the process of soap formation conservation in a –DAHGD-residue string at the
using a triglyceride as the starting molecule. putative metal binding site.
The saponification reaction is
a. the alkaline oxidation of aldehydes.
b. the alkaline hydrolysis of esters.
c. the acidic cleavage of glycols.
d. acidic reduction of carboxylic acids.

38. The type of radioactive decay that does NOT

change the atomic number of a nucleus is
a. a decay.
b. b decay.
c. γ decay.
d. electron capture.

59
 –M C AT ® E X A M P R A C T I C E T E S T 1–

(nmol L-orn/min/mg prot)

25

Arginase Activity
20

15

10

0 No Metal

MnSO4

CoCl2

NiCl2

FeSO4

CaCl2

MgSO4

ZnCl2

CuSO4
A

800
(nmol L-orn/min/mg prot)

600
Arginase Activity

400

200

0
No Metal

MnSO4

CoCl2

NiCl2

FeSO4

CaCl2

MgSO4

ZnCl2

CuSO4
B

Figure 1. Arginase assay results for RocF activity in the presence of several different metals at pH 6.3 (A) and pH 9.0 (B).

60
(nmol L-orn/min/mg prot)

50
Arginase Activity

40

30

500 20
Manganese
(nmol L-orn/min/mg prot)

10

400 0
0 0.2 0.4 0.6 0.8 1
Arginase Activity

Metal Concentration (µM)

300 Cobalt
Manganese
200 Nickel

100

0
0 100 200 300 400 500

Metal Concentration (µM)

Figure 2. Viable cell arginase assay results in the presence of three metals of interest.
Ryan J. Viator, Richard F. Rest, Ellen Hildebrandt, David J. McGee. BMC Biochemistry. 2008;9:15. doi:10.1186/1471-2091-9-15.
These images are available from http://www.biomedcentral.com/1471-2091/9/15. © 2008 Viator et al; licensee BioMed Central Ltd.

60
 –M C AT ® E X A M P R A C T I C E T E S T 1–

39. Which of the tested metal ions has the largest 42. The data in Figure 1 (page 60) directly show
ionic radius? that changing the pH from 6.3 to 9 effectively
a. Mg2+ changes
b. Ca2+ a. the binding affinity of RocF for each metal.
c. Ni2+ b. the ability of b. anthracis cells to survive in
d. Zn2+ the presence of each metal.
c. the overall order of metal preference in
40. Based on the description of the arginase reac- RocF.
tion in the passage, what is the structure of d. the rate of the arginase reaction in RocF for
L-ornithine? each metal.
a. NH O
O 43. The table below provides the pKa values for
H2N N OH
H several relevant amino acids in the structure of
NH2
RocF:
b. O
1-LETTER
H2N OH AMINO AMINO sIdE
NH2 ACId NAME ACId COdE CHAIN pK a

c. O Alanine A Not ionizable

H2N Aspartate D 3.9
OH
NH2 Glycine G Not ionizable
Histidine H 6.0
d. O O

H2N N OH Assuming that pKas are not affected by the

H surrounding protein structure, the majority
NH2
(at least three) of the five residues in the con-
41. In comparison with arginase from H. pylori, served putative metal binding site are
RocF from b. anthracis has
a. uncharged at pH 6.3 and 9.0.
a. the same metal preference and optimal pH.
b. charged at pH 6.3 and 9.0.
b. the same metal preference but a different
c. aromatic.
optimal pH.
d. hydrophobic.
c. a different metal preference but the same
optimal pH.
d. a different metal preference and a different
optimal pH.

61
 –M C AT ® E X A M P R A C T I C E T E S T 1–

44. The data collected in Figures 1 and 2

collectively suggest that, in vivo, b. anthracis
a. cannot grow in the presence of Co2+ and
Ni2+, even though RocF preferentially uses
these metals.
b. specifically and efficiently imports Mn2+, but
not Co2+ or Ni2+, preventing RocF from
using its preferred metal.
c. does not exhibit arginase activity at all
unless the protein is expressed and purified
in E. coli.
d. exhibits the most rapid rate of arginase
activity at very low Mn2+ concentrations.

Questions 45 through 49 are based on the following passage.

The Prins reaction is the acid-catalyzed addition of aldehydes to alkenes. A general scheme for the Prins reac-
tion is shown in Figure 1. With water and a protic acid as the reaction medium, the 1,3-diol is the reaction
product. When water is absent, the allylic alcohol forms. A molar excess of formaldehyde and reaction temper-
ature lower than 70°C gives the dioxane product. The replacement of water with acetic acid forms the corre-
sponding esters.

and/or

alkene formaldehyde
1,3-diol allylic alcohol
+ various other products

1,3-diol 1,3-dioxane

Figure 1. A general scheme for the Prins reaction.

In a putative general mechanism for the Prins reaction using formaldehyde, the first step is the proton-
ation of the oxygen in formaldehyde to form a carbocation, followed by the addition of the alkene (CH2 =
CRR') to form a new carbocation X (Figure 2A). Carbocation X then reacts with water to form the 1,3-diol.
The 1,3-diol is then protonated at its alcohol, forming water as a leaving group, which makes the allylic alcohol
product. Carbocation X also reacts with the aldehyde to form a linear ether−containing carbocation, which
cyclizes to form the 1,3-dioxane product.

62
 –M C AT ® E X A M P R A C T I C E T E S T 1–

The Prins reaction was performed by reacting 46. The formation of the allylic alcohol from
isobutylene (Figure 2B) with formaldehyde. The 1,3-diol is
main products formed are 75% 1,3-dioxane (Figure a. an elimination reaction.
2C) and 9% 1,3-diol. b. a hydrolysis reaction.
c. a tautomerization reaction.
A B C d. a nucleophilic substitution reaction.

47. Which set of reaction conditions could have

been used to obtain the products in the isobu-
tylene Prins reaction with formaldehyde
Figure 2. Relevant intermediates, reactants, and products
described in the passage?
for the Prins reaction. A, carbocation X; B, isobutylene; C, a. (CH3)2CO (aq), 32°C, 3:4
1,3-dioxane. alkene:formaldehyde molar ratio
Shinichi Yamabe, Takeshi Fukuda, Shoko Yamazaki. Beilstein
J Org Chem, 2013, 9, 476–485. This passage contains excerpts b. H2SO4 (aq), 32°C, 3:4 alkene:formaldehyde
from this work. The entire article can be found at http://www molar ratio
.beilstein-journals.org/bjoc/content/pdf/1860-5397-9-51.pdf.
c. (CH3)2CO (aq), 75°C, 4:3
alkene:formaldehyde molar ratio
45. In the general Prins reaction mechanism, why
d. H2SO4 (aq), 75°C, 4:3 alkene:formaldehyde
does the CH2 carbon of the alkene, and not
molar ratio
the CRR' carbon, bond with the carbon on
the protonated formaldehyde to form X
48. What is the correct IUPAC name of the
(Figure 2)?
1,3-diol that forms during the isobutylene
a. The electronegativity difference between C
Prins reaction with formaldehyde?
and H in the C-H bonds of the alkene gives
a. 1,1-dimethyl-1,3-propanediol
the CH2 carbon slightly less electron pull
b. 2,2-dimethyl-1,2-propanediol
than the CRR' carbon.
c. 2-methyl-2,4-butanediol
b. The bond formation with the CH2 carbon
d. 3-methyl-1,3-butanediol
over the CRR' carbon forms a more stable
tertiary carbocation.
49. What is the orbital hybridization of the oxygen
c. Mechanistically, this mode of bond
atoms in 1,3-dioxane?
formation provides the most stable pi bond
a. sp
arrangement, according to Hückel’s rule.
b. sp2
d. The bond formation with the CH2 carbon
c. sp3
over the CRR' carbon is less sterically
d. sp3d
favorable, but the bond energy of the new
bond is significantly higher.

63
 –M C AT ® E X A M P R A C T I C E T E S T 1–

Questions 50 through 52 are based on the following 51. Based on the structure of LSD, which of the
passage. nitrogen atoms in the molecule is the most
basic?
Lysergic acid diethylamide (LSD) is a psychedelic a. Nitrogen atom 1
drug and powerful hallucinogen that was first b. Nitrogen atom 2
synthesized in 1938 from ergotamine, a chemical c. Nitrogen atom 3
derived from a grain fungus that often grows on rye. d. All three nitrogen atoms are equally basic.
The chemical structure of LSD is shown in Figure 1,
with its three nitrogen atoms numbered 1−3 and 52. Why is the proton on C-8 labile?
with carbon 8 labeled C-8. a. The carboxamide group on the molecule is
electron withdrawing.
b. The pi electron delocalization on the indole
1 ring and the nearby nitrogen are electron
N O
withdrawing.
C-8 c. The steric stress from bulky groups increases
the lability of the C-8 proton.
H 2
d. The structural stress from the planarity of
N
LSD increases the lability of the C-8 proton.

HN3

Figure 1. The chemical structure

of lysergic acid diethylamide.

50. How many unique stereoisomers are possible

for the LSD molecule?
a. 1
b. 2
c. 4
d. 8

64
 –M C AT ® E X A M P R A C T I C E T E S T 1–

53. The stretching frequencies of several functional 54. Sulfur dioxide reacts with oxygen in an
groups are shown below: enclosed container as follows:

2SO2(g) + O2(g) 2SO3(g) ∆H = –198.2 kJ

FuNCTIONAL sTRETCHING FREquENCIEs
GROuPs (WAVENuMBERs) Which of the following changes will shift the
Alcohols 3590−3650 equilibrium to the left?
Alkanes 2800−3000 a. Adding a catalyst
Alkenes 3000−3100 b. Adding O2
c. Decreasing the pressure
Amines 3300−3500 (doublet for NH2)
d. Decreasing the temperature
Aromatics 1500−1600
Carboxylic Acids 2500−3300
55. Plant sucrose uptake transporters (SUTs) are
Nitriles 2220−2260 H+/sucrose symporters, and OsSUT1 is a type
Using the table of functional groups, which II SUT. The OsSUT1(R188K) mutant was
molecule corresponds with the infrared (IR) made that replaced lysine with arginine at posi-
spectrum below? tion 188, altering a key residue in the trans-
membrane portion of the protein. R188H and
% 80
R188M mutants did not localize to the mem-
70
T
r
brane. 14C sucrose uptake by yeast expressing
60
a
n
s 50 wildtype OsSUT1, the mutant, and an empty
m
i 40 pDR196 gene vector was measured at pH 4.0
t
t 30
a and 7.0, at 30˚C for 5 minutes each. The results
n 20
c
e 10
are shown in the graph below:
3,500 3,000 2,500 2,000 1,500 1,000
nmol sucrose (108 cells)–1

Wavenumbers
4
pH 4.0
a. O 3 pH 7.0

NH2 2
b. H3C N 1
c. 0
NH OsSUT1 OsSUT1R188K pDR196

Sun and Ward. Arg188 in rice sucrose transporter OsSUT1 is cru-

d. O cial for substrate transport. BMC Biochemistry. 2012;13:26.

OH Based on the results obtained, OsSUT1 will

localize and function properly at pH 4.0 as
long as residue 188
a. is positively charged.
b. can form a bidentate H-bond.
c. is hydrophobic.
d. has a low enough molecular weight.

65
 –M C AT ® E X A M P R A C T I C E T E S T 1–

56. Consider the following redox reaction acidic 59. The Lewis acid-base reaction between boron
solution: trifluoride and ethanol produces
– a. one zwitterionic compound.
H2S + NO3 → S8 + NO
b. one charged compound.
When balanced using the smallest possible c. two neutral compounds.
integers, the coefficient for H2S is d. two charged compounds.
a. 4.
b. 8. H
–
c. 16. CH3OH + BF3 CH3—O—BF3
+
d. 24.

57. The following data were obtained for this

hypothetical reaction:

A+B→C

INITIAL RATE OF [C]

[A] 0 , mM [B] 0 , mM PROduCTION (mM/s)

120 170 4,705

360 170 4,698
360 340 18,800

Based on the data, which of the following mea-

surements should be linear, with slope k or –k,
as a function of time?

a. [A]
b. [B]
c. [A]–1
d. [B]–1

58. Fractional distillation is a method used to sep-

arate two or more liquids in the same mixture.
This method relies on differences between the
liquids in
a. polarity.
b. density.
c. boiling point.
d. solubility in two distinct solvents.

66
 –M C AT ® E X A M P R A C T I C E T E S T 1–

Part 3: Psychological, social, 2. According the theories upon which this study
and Biological Foundations is based, children in the concrete operational
of Behavior stage have problems with which of the
following?
59 Questions a. Deductive logic
95 Minutes b. Perspective taking
c. Inductive logic
Use the following passage to answer questions 1 d. Conservation
through 5.
3. If the treatment in this study were considered
An experimenter wanted to see if a new form of to be a stressor, what was the effect of the
teaching would help accelerate the cognitive stressor on the children who succeeded in the
development of eighth- and ninth-grade science study?
students. He hypothesized that the new method, a a. They did best if they received the familiar to
“flipped” classroom method where students worked unfamiliar treatment.
on homework and group assignments in class and b. They moved from one developmental stage
listened to lectures at home, would accelerate the to the next.
students’ cognitive development. To test this c. They were relaxed, so they did well in the
hypothesis, students were randomly assigned into study.
two groups. One group was taught a concept in the d. They were better at combinatorial reasoning
traditional lecture method in class, while the other than propositional logic.
was given the “flipped” classroom method. After
eight weeks, the experimenter compared scores of 4. The study compared the group means on a
both groups using the same critical thinking critical thinking assessment. What type of sta-
assessment. The results suggested that although there tistics are used when comparing the means of
was a great deal of variability within each group and groups?
cognitive development did improve in some a. Inferential
students, overall there were no statistically significant b. Estimation
differences between the traditional lecture and the c. Descriptive
“flipped” classroom conditions. d. Modeling

1. Based on the information in the passage, whose 5. What physiological change occurs in children
developmental theory was this study grounded as they move from concrete operational to for-
in? mal operational stages of cognitive
a. Erikson’s development?
b. Freud’s a. The limbic system is altered.
c. Maslow’s b. Changes in the brain occur in the memory
d. Piaget’s storage area.
c. Psychological functioning changes, but the
structure of the brain does not change.
d. The structure of the brain changes.

67
 –M C AT ® E X A M P R A C T I C E T E S T 1–

6. Which of the following is a correlation that Use the following passage to answer questions 10
BEST supports Maslow’s hierarchy of needs? through 14.
a. Children living in poverty tend to be victims
of violent crime. Social thinking is what we do when we interact with
b. Children living in poverty and/or in violent people: we think about them. And how we think
neighborhoods tend to do less well in school about people affects how we behave, which in turn
than their affluent peers. affects how others respond to us, which in turn
c. Children who interact with their affects our own emotions. Whether we are with
environment develop deeper knowledge friends, sending an e-mail, in a classroom, or at the
structures than children who do not. grocery store, we take in the thoughts, emotions, and
d. Children who receive scaffolded instruction intentions of the people we are interacting with.
learn relationships between concepts faster Most of us develop our communications sense
than those who do not. from birth onward, steadily observing and acquiring
social information and learning how to respond to
7. The sense of having always known a person people. Because social thinking is an intuitive
whom we just met is an example of which of process, we usually take it for granted.
the following in romantic love? But for many individuals, this process is
a. Attachment anything but natural. And this often has nothing to
b. Attraction do with conventional measures of intelligence. In
c. Love fact, many people score high on IQ and standardized
d. Lust tests yet do not intuitively learn the nuances of social
communication and interaction.
8. Which part of the brain confers an evolution- While these challenges are commonly
ary advantage by allowing parallel processing? experienced by individuals with autism spectrum
a. Only the right brain disorders (high functioning), social communication
b. Only the left brain disorder, Asperger’s, attention deficit hyperactivity
c. Conus medullaris disorder (ADHD), nonverbal learning disability
d. Lateralization of cortical functions (NLD), and similar diagnoses, children and adults
experiencing social learning difficulties often have
9. Spatial cognition and cognitive mapping are received no diagnosis.
often found in which of the following? A treatment framework and curriculum
a. Reinforcement schedules developed by Michelle Garcia Winner targets
b. Avoidance learning improving individual social thinking abilities,
c. Spontaneous recovery regardless of diagnostic label. Professionals and
d. Associative learning parents alike are using these methods to build social
thinking and related skills in students and adults.
Social thinking books, workshops, and trainings by
Winner or based on Winner’s work now offer a range
of strategies that address individual strengths and
weaknesses in processing social information.

68
 –M C AT ® E X A M P R A C T I C E T E S T 1–

Research is beginning to support the effective- 12. If a type of social thinking intervention were to
ness of teaching social thinking. The Journal of be tested using experimental design, the
Autism and Developmental Disorders published a outcome of the experiment would be MOST
report on methodologies specifically addressing related to which of the following?
weaknesses in the social thinking process, finding a. Control group
that they are successful at teaching the ability to b. Dependent variable
interact socially in people with social limitations who c. Experimental group
have near-average to very high intelligence. d. Independent variable

10. Based on the article, which of the following is 13. Why do most people take social thinking for
TRUE? granted?
a. All people experiencing social thinking a. It is closely related to IQ, which means it is
difficulties have a diagnosis. an intuitive process.
b. Parents are using strategies to help their b. It is learned quickly from the environment,
children overcome social thinking so most people do not even notice it.
difficulties. c. Most people who have trouble with social
c. Research does not support teaching thinking have a diagnosis, so for those
methodologies that claim to help overcome without a diagnosis, it is an intuitive process.
social thinking difficulties. d. It is an intuitive process, so it is not noticed,
d. Most social learning occurs during even in the most severe cases.
preadolescence and adolescence.
14. What is unique about Winner’s work on social
11. Interventions have been developed for people thinking?
with social thinking difficulties. Which of the a. It is being used not only by practitioners but
following is MOST correct about these also by parents.
interventions? b. It can only be used with patients with a
a. Social thinking is a natural process for secondary diagnosis.
everyone, so interventions have not been c. It is not based on research on social thinking
effective. and has not contributed to the field.
b. Only people best at social thinking have high d. It has failed to help people with near-average
IQs, so interventions have focused on to above-average intelligence.
individuals with lower IQs.
c. Interventions on social thinking have found Use the following passage to answer questions 15
that the interventions are effective with through 19.
people who have high IQs.
d. There are few interventions available, and The term mental illness clearly indicates that there is
those are directed at individuals with a problem with the mind. But is it just the mind in
diagnostic labels. an abstract sense, or is there a physical basis to
mental illness? As scientists continue to investigate

69
 –M C AT ® E X A M P R A C T I C E T E S T 1–

mental illnesses and their causes, they learn more complete understanding of what causes mental
and more about how the biological processes that illnesses. If you think about the structural and
make the brain work are changed when a person has organizational complexity of the brain, together with
a mental illness. the complex effects that mental illnesses have on
How does the brain take in all of this informa- thoughts, feelings, and behaviors, it is hardly
tion, process it, and cause a response? The basic surprising that figuring out the causes of mental ill-
functional unit of the brain is the neuron. A neuron nesses is a daunting task.
is a specialized cell that can produce different actions Most scientists believe that mental illnesses
because of its precise connections with other neu- result from problems with the communication
rons, sensory receptors, and muscle cells. A typical between neurons in the brain. For example, the level
neuron has four structurally and functionally defined of the neurotransmitter serotonin is lower in
regions: the cell body, dendrites, axons, and axon individuals who have depression. This finding led to
terminals. the development of certain medications for the
When the electrical signal reaches the illness. Selective serotonin reuptake
presynaptic axon terminal, it cannot cross the inhibitors (SSRIs) work by reducing the amount of
synaptic space, or synaptic cleft. Instead, the serotonin that is taken back into the presynaptic
electrical signal triggers chemical changes that can neuron. This leads to an increase in the amount of
cross the synapse to affect the postsynaptic cell. serotonin available in the synaptic space for binding
When the electrical impulse reaches the presynaptic to the receptor on the postsynaptic neuron. Changes
axon terminal, membranous sacs called vesicles move in other neurotransmitters (in addition to serotonin)
toward the membrane of the axon terminal. When may occur in depression, thus adding to the
the vesicles reach the membrane, they fuse with the complexity of the cause underlying the disease.
membrane and release their contents into the Scientists believe that there may be disruptions
synaptic space. The molecules contained in the in the neurotransmitters dopamine, glutamate, and
vesicles are chemical compounds called norepinephrine in individuals who have
neurotransmitters. schizophrenia. One indication that dopamine might
The nervous system uses a variety of be an important neurotransmitter in schizophrenia
neurotransmitter molecules, but each neuron comes from the observation that cocaine addicts
specializes in the synthesis and secretion of a single sometimes show symptoms similar to schizophrenia.
type of neurotransmitter. Some of the predominant Cocaine acts on dopamine-containing neurons in the
neurotransmitters in the brain include glutamate, brain to increase the amount of dopamine in the
GABA, serotonin, dopamine, and norepinephrine. synapse.
Each of these neurotransmitters has a specific
distribution and function in the brain.
Research scientists want to learn about the
chemical or structural changes that occur in the
brain when someone has a mental illness. If scientists
can determine what happens in the brain, they can
use that knowledge to develop better treatments or
find a cure. At this time, scientists do not have a

70
 –M C AT ® E X A M P R A C T I C E T E S T 1–

15. Where in the structure of the neuron are neu- Use the following passage to answer questions 20
rotransmitters found? through 24.
a. At the axon of the presynaptic neuron
b. In vesicles located at the presynaptic axon A North American middle school was the setting of a
terminal research study about the implementation of an
c. In the dendrite intervention to prevent gendered harassment. The
d. In the cytoplasmic connection between the teachers in the school (n = 70) were divided into two
two neurons groups (n = 35 each), one that received the
intervention and one that did not. All of the teachers
16. Schizophrenia is likely to be caused in cocaine in the school participated in the study. The
users by an increase of which of the following intervention included a week-long training during
neurotransmitters? the summer about gender roles, gender
a. Serotonin identification, and gendered harassment. A major
b. Glutamate component of the training was to have the teachers
c. Dopamine identify and confront their limiting beliefs about
d. Norepinephrine gender identity in general and gender in
preadolescents in particular. This process upset many
17. Which of the following are MOST likely to of the teachers to the point where six teachers almost
experience vicarious emotional trauma when dropped out of the study. However, all six worked
dealing with mental illness? through their feelings and made the commitment to
a. Mental health workers continue in the study. During the fall semester of the
b. Patients with bipolar disorder school year, the teachers in the intervention group
c. Patients with alcoholism met a minimum of twice a week for 30 minutes to
d. Patients with schizophrenia discuss in small groups the issues they were facing,
and specific challenges were addressed. The
18. Dysfunctional mirror neuro activity (MNA) researchers also met with the participants in a large
may be found in which of the following mental group once a month for a 2-hour debriefing to
conditions? discuss issues raised by the small groups and to
a. Bipolar disorder and major depression provide additional training as necessary. Teachers in
b. PTSD and eating disorders the intervention group also were encouraged to keep
c. Obsessive-compulsive disorder and a diary, personal blog, or some other record of their
antisocial personality disorder experiences. All 35 began the diary process, but only
d. Autism and schizophrenia 27 used it consistently during the intervention. Some
of these teachers went even further and formed
19. Mental disorders such as generalized anxiety online groups. The entire school-based portion of
disorder are generally caused by problems with the intervention lasted one semester (15 weeks).
which of the following? Data were collected in the following manner
a. Axons from all 70 teachers and their students. Classroom
b. Neurons observations were made during weeks 1 and 2, weeks
c. Neurotransmitters 7 and 8, and weeks 14 and 15. All teachers were
d. Substance abuse interviewed at the beginning and end of the study.

71
 –M C AT ® E X A M P R A C T I C E T E S T 1–

Students were given a Likert-type questionnaire 21. Based on the results of the study, which of the
during weeks 1 and 15. This questionnaire was following is a reasonable conclusion that can
administered in a single setting. There was one be made about gendered harassment
significant difference on the student questionnaire at interventions?
the beginning of the study, which was that a. The programs work if teachers and
transgender students were more likely to report administrators are committed to them.
feeling bullied. Qualitative data were quantified b. The programs were proven effective at
where appropriate, and statistical tests of significance reducing bullying in the classroom.
were performed. The observational data showed that c. Putting bullying students through similar
the teachers who were in the intervention group were interventions will reduce their tendency to
more effective at dealing with incidents of bullying at bully.
the times they occurred than the nonintervention d. Community conformity is a contributing
group. The students of the teachers in the factor that can lead to the lack of success of
intervention group were significantly less likely to these programs.
express or conversely be the victims of gendered
harassment after the intervention. For the 22. During the teacher learning phase, several
nonintervention group, perceived lack of teachers had personal experiences that led to a
administrative support and lack of training were the decision to almost drop out of the program. All
most common reasons given for failure to deal with eventually stayed. Which is the best term for
gendered harassment in the classroom. Both groups these teachers’ personal experiences?
expressed fear of parental backlash and lack of a. Adaptation
community conformity as reasons that gendered b. Cognitive dissonance
harassment interventions may not be very effective. c. Cultural conformity
d. Independent variable
20. The teachers who did NOT receive the
intervention in the study are referred to as 23. Which variable in this study is socially
which of the following? constructed?
a. Control group a. Gender
b. Experimental group b. Sex
c. Dependent variable c. Age of students
d. Independent variable d. Treatment length

72
 –M C AT ® E X A M P R A C T I C E T E S T 1–

24. Which of the following statements is an exam- Use the following chart to answer questions 28
ple of a view consistent with the hidden curric- through 32.
ulum in the context of this study?
a. Students with different gender identities get THE STRESS RESPONSE CURVE

bullied because it prepares them for real-life

Good Stress Distress
discrimination.
b. The nature of the bullying intervention was
known only to the teachers and not to the Stress Management Increasing
the Performance Level
students. P Actual Performance
E
c. Bullying is unacceptable in all situations. R FATIGUE
F
d. Bullying is the fault of parents. O
Exhaustion

R
COMFORT
M
ZONE
A
25. A family immigrates to a new country and N
Ill Health

C
strives to fit in. The parents insist the children E
BREAKDOWN
speak only the new language in the home, and
the adults strive to join many social groups and
Adapted from Nixon P, Practitioner, 1979
make many new friends from their new coun- AROUSAL STRESS
try. Which term is this cultural process is
known as?
a. Accommodation 28. According to the graph, at what point is stress
b. Assimilation no longer beneficial?
c. Functionalism a. When side effects to health occur
d. Stratification b. When the comfort zone is achieved
c. When performance is maximized
26. All of the following are forms of signals that d. When fatigue occurs
animals use, EXCEPT
a. adaptation. 29. If an experiment were performed to compare
b. gaze following. the difference between one group receiving
c. electrocommunication. stress management treatment and the other
d. olfactory. group not receiving treatment, what kind of
research design would be used?
27. Which of the following was the first theory of a. Case study
motivation? b. Experimental
a. Incentive theory c. Cross-sectional
b. Arousal theory d. Descriptive
c. Humanistic theory
d. Drive reduction theory

73
 –M C AT ® E X A M P R A C T I C E T E S T 1–

30. The information in the graph is based on the Use the following passage to answer questions 33
work of which of the following theorists? through 37.
a. Cannon-Bard
b. James-Lange The New York Times notes that “more than 6 percent
c. Piaget-Maslow of American teenagers are clinically depressed.”
d. Schachter-Singer There are many different causes of teen depression, a
disorder that can be a precursor to teen suicide
31. An experiment was performed to compare the attempts. Screening for teen depression is crucial and
difference between one group receiving stress is now performed at the offices of many
management treatment and the other group pediatricians. About 70 percent of teens with
not receiving treatment. A requirement of the depression fail to seek medical treatment or therapy.
study was to turn in a signed IRB form. Subject Thus, parents must be proactive to watch for signs of
X did not turn in his form by the time the depression in teens.
study started but was considered by the Daily life for teenagers is often stressful and
research team to be a desirable subject for the causes many teenagers to feel tormented, isolated,
study. What should the researchers do? and different from others. This stress may be a factor
a. Let Subject X participate without the form. leading to depression. Problems such as bullying,
b. Give Subject X a deadline of 2 weeks to turn violence, and gossip are part of daily life for teens.
in the form. Since teens’ brains are not yet fully developed, they
c. Allow Subject X to be included as long as the do not have the logic skills to work through the
form is turned in by the end of the study. difficult situations these experiences may create.
d. Not allow Subject X to participate in the Teenagers who have to handle a lot of change in
study because he did not follow study their lives may be more susceptible to bouts of
protocol. depression. Major life changes such as the divorce of
parents, loss of a friend or relationship, death in the
32. While the theoretical constructs of the theory family, unemployment of a parent, relocation away
this graph was based on are now mostly obso- from friends, or sudden disability can cause
lete, the relationship shown in the graph is an enormous stress for a teenager. Teenagers may
example of modern use. What is another overreact to stress and changes in life and may
example? succumb to negative thinking and depression.
a. A person is aroused and has no immediate If a teenager abuses alcohol or drugs, this may
explanation, so he labels this state and lead to depression. Alcohol is a depressant. Drug use
describes his feelings in terms of the may impair the brain’s ability to function properly
thoughts available to him at the time. and impact the hormonal system, which can lead to
b. Crying and trembling in public, which is depression. When depression arises, teens may limit
caused by the person’s emotions. social interaction, let grades drop, attempt suicide,
c. Becoming ill in public, which leads to drop out of school, stop participating in school activ-
anxiety, which leads to avoidance of being in ities, or fight with peers and parents. Teens under
public. stress and using drugs and alcohol are susceptible to
d. Being anxious in public, which leads to negative thinking, which can lead to depression.
avoidance of being in public.

74
 –M C AT ® E X A M P R A C T I C E T E S T 1–

As hormones surge in teenagers, they may feel 34. Which agent of socialization is MOST likely to
overwhelmed by the changes in their bodies and be the location of the stressors that cause
their moods. They may experience foul moods, may depression?
have a hostile attitude, and may be involved in self- a. Mass media
destructive acts such as cutting or promiscuous b. School
behavior. A teenager often does not understand the c. Church
mood swings that surging hormones can create. d. Workplace
They may become withdrawn and start to experience
depression due to feeling out of control of their 35. In what way does mass media influence teens’
changing bodies. development?
Teenagers must work to avoid causes of a. Teens tend to be very devoted to the music
depression and focus on the positive aspects of life. they listen to, and this influences their
Ongoing exercise at least three times a week helps identity formation.
prevent depression. It is also helpful to spend time b. Most teens tend to emulate the movie and
with positive and achievement-oriented friends. television stars they admire, and this can
Participating in hobbies that bring joy is also helpful influence their gender identity.
to prevent the onset of depression. Other ways to c. Media usually positively affects their self-
work to prevent depression include getting at least efficacy.
eight hours of sleep a night, avoiding pessimistic d. Media influences their class identity.
thoughts, talking to a doctor or guidance counselor
if stressed or in crisis, eating healthy foods and 36. Which social support system is MOST likely to
avoiding junk food, avoiding sad music, and avoiding help prevent teen depression?
friends who abuse drugs or alcohol. a. Church and church-related activities
b. Friends in physical education class
33. According to the article, which of the following c. School
is a stressor that can cause teens to be d. Family
depressed?
a. Peer pressure 37. Low self-efficacy can MOST likely result from
b. Daily exercise exposure to which of the following stressors?
c. Cutting and promiscuity a. Family life
d. Reducing participation in school activities b. Music, especially the music they listen to
most
c. Mass media, such as billboards and
magazines
d. Workplace

75
 –M C AT ® E X A M P R A C T I C E T E S T 1–

38. A child knows that thunder is caused by light- Use the following passage to answer questions 43
ning but does not understand the causal mech- through 47.
anism between the two. In which stage of
Piaget’s developmental model does the child Over the past few years, America’s city centers have
most likely belong? experienced revitalization. This has brought new life
a. Concrete operational to cities and also put a premium on urban
b. Formal operational neighborhoods. Housing in such areas is scarce and
c. Preoperational often cannot grow at the rate that the population
d. Sensory-motor does. As an alternative, people are moving to and
building homes in areas that were once considered
39. Which of the following is TRUE about ethno- undesirable. Gentrification often occurs in these
centrism AND cultural relativism? areas, which have specific qualities that make them
a. They are only found in individuals. ideal. The biggest draw to these areas may be the
b. They are only found in specific nations. availability of inexpensive housing, especially to
c. They are found in BOTH individuals and younger generations who see older houses that
specific nations. haven’t been maintained as “fixer-uppers” and
d. They are found in NEITHER individuals nor investment opportunities.
specific nations. Gentrification occurs through gradual increase
in new people to a formerly undesirable
40. Which of the following BEST describes groups neighborhood. At first, many people are unwilling or
making decisions that are more than the initial afraid to move into an unfamiliar neighborhood
inclinations of its members? across class and racial lines. However, a small
a. Deindividuation number of people do, and then through word of
b. Deviance mouth, more people are willing to move. This
c. Groupthink snowball effect leads to an accelerated growth in an
d. Group polarization area that was once stagnating.
While gentrification has benefits, it also has
41. Which of the following models or theories consequences. As more people move to the new
includes persuasion as a major component? neighborhood, housing prices can become more and
a. Elaboration likelihood model more inflated, as can the prices of food, gas, and
b. Social cognitive theory other costs of living. In addition, although
c. Enculturation theory gentrification may bring vitality and economy to a
d. Observational learning model neighborhood that once lacked these attributes, it
often displaces the existing residents.
42. A person going to an interview presents herself Despite this, gentrification supporters focus on
in a certain way, including speech, body lan- the advantages of urban and environmental
guage, and clothing. By doing so, she is practic- sustainability of city living. Policymakers are
ing which of the following? urging populations to live in highly populated cities
a. Using gender in the detection of emotion contained within a small radius, in which mobility
b. Nonverbal communication practices will become more localized. Although
c. Social interactionism gentrification is being promoted as a way to sustain
d. Impression management

76
 –M C AT ® E X A M P R A C T I C E T E S T 1–

urban areas in the future, its success may leave those 47. Which is most likely to occur in gentrified
native to their existing communities without one. neighborhoods?
a. Assimilation of new families into existing
43. Gentrification is most different from which of culture
the following processes? b. Poor families being driven out of their
a. Meritocracy existing neighborhood
b. Urban blight c. Less violence in the family
c. Intergenerational mobility d. Culture lag
d. Social stratification
Use the following passage to answer questions 48
44. A problem that people moving into gentrifying through 50.
neighborhoods experience is MOST likely
which of the following? A study was undertaken to determine if there were
a. Healthcare disparities differences in the health beliefs, health locus of
b. Declining housing values control, and self-concept of adult women who
c. Global inequalities practice breast self-examination (BSE) compared
d. Relative and absolute poverty with women who do not. A sample of 207 women,
drawn from a variety of settings, completed four
45. Which of the following will likely have to be research instruments. Analysis of the data revealed
improved because of gentrification? differences between the practice and non-practice
a. The number of parks in the gentrified groups in terms of health beliefs, health locus of
neighborhood control, and self-concept, as well as a positive
b. The variety of restaurants in the relationship between the measure of health belief
neighborhood and the measure of self-concept. Specifically, the
c. Availability of public transportation group that practiced BSEs had higher levels of health
d. The pace of change in the neighborhood beliefs and higher self-concept levels than the group
that did not. Also, those who practiced BSEs tended
46. The children from the original neighborhood to be less inclined to have a health locus of control
and children coming into the gentrified neigh- that depended on a powerful other, in this case a
borhood may both experience all of the follow- physician.
ing within the education system EXCEPT
a. hidden curriculum. 48. In this study, the relationship between higher
b. in-group bias. health beliefs and self-concept would be con-
c. meritocracy. sidered which of the following?
d. displacement. a. Correlational
b. Causal
c. Predictive
d. Variable

77
 –M C AT ® E X A M P R A C T I C E T E S T 1–

49. What is a locus of control? Use the following passage to answer questions 52
a. A psychological model that attempts to through 56.
explain and predict behaviors related to
issues like health A doctor is examining a CT scan, looking for
b. An idea of the self, constructed from the evidence of a tumor. Either there is a tumor (signal
beliefs one holds about oneself and the present) or there is not (signal absent). Either the
responses of others doctor sees a tumor (she responds “yes”) or does not
c. The extent to which individuals can control (she responds “no”). There are four possible
events affecting them outcomes: hit (tumor present and doctor says “yes”),
d. One’s confidence in one’s own worth or miss (tumor present and doctor says “no”), false
abilities and one’s self-respect alarm (tumor absent and doctor says “yes”), or
correct rejection (tumor absent and doctor says
50. If an experiment was designed to train those in “no”). Hits and correct rejections are good. False
the non-practice group to start practicing alarms and misses are bad.
BSEs, what would be the dependent variable in Detecting a tumor is difficult, and there will
the study? always be some amount of uncertainty. There are two
a. The control group kinds of noise factors that contribute to the
b. The treatment group uncertainty: internal noise and external noise.
c. The training the experimental group External noise: There are many possible
received sources of external noise. There can be noise factors
d. Whether the group receiving the treatment that are part of the photographic process, a smudge,
started practicing breast self-exam or a bad spot on the film. Or there can be something
in the person’s lung that is fine but looks a bit like a
51. An on-duty nurse receives a call at the hospital tumor. All of these are examples of external noise.
in which the caller identifies himself as a doc- Internal noise: Internal noise refers to the fact
tor. He advises the nurse to give a large dose of that neural responses are noisy. For example, a
medication to a patient. The highest allowable doctor may see many tumors a day and as such
dose of the medication is 10 mg; however, the develop a set of neurons used when making decisions
doctor advises the nurse to administer 20 mg. on whether a scan shows a tumor. These hypothetical
Despite the possible deadly consequences of tumor detectors will give noisy and variable
such a high dose, the nurse administers the responses. After one glance at a scan of a healthy
medication without asking any questions. This lung, the hypothetical tumor detectors might fire 10
is an example of spikes per second. After a different glance at the same
a. peer pressure. scan and under the same conditions, these neurons
b. obedience. might fire 40 spikes per second.
c. bystander effect. Internal response: It is actually not likely that
d. social loafing. there are tumor detector neurons in a radiologist’s
brain. But there is some internal state, reflected by
neural activity somewhere in the brain, that
determines the doctor’s impression about whether a

78
 –M C AT ® E X A M P R A C T I C E T E S T 1–

tumor is present. This is a fundamental issue; the 55. Two sets of doctors (first-year residents and
state of the doctor’s mind is reflected by neural attending physicians) were compared based on
activity somewhere in her brain. This neural activity their resulting outcomes for a set of radiologi-
might be concentrated in just a few neurons, or it cal images using experimental design. If the
might be distributed across a large number of attending physicians were the control group,
neurons. Since we do not know much about where/ what were the first-year residents?
when this neural activity is, let’s simply refer to it as a. The dependent variable
the doctor’s internal response. b. The independent variable
This internal response is inherently noisy. Even c. The experimental group
when there is no tumor present (no-signal trials), d. The treatment group
there will be some internal response (sometimes
more, sometimes less) in the doctor’s sensory system. 56. Which of the following quotes from the pas-
sage is an example of neuroscience?
52. Which of the following does this passage refer a. “This internal response is inherently noisy.
to? Even when there is no tumor present
a. Sensory adaptation (no-signal trials), there will be some internal
b. Signal detection theory response (sometimes more, sometimes less)
c. Somatosensory system in the doctor’s sensory system.”
d. Weber’s law b. “Detecting a tumor is difficult, and there will
always be some amount of uncertainty.”
53. The doctor’s neural activity in the brain is an c. “Or there can be something in the person’s
example of which of the following? lung that is fine but looks a bit like a tumor.”
a. Internal noise d. “But there is some internal state, reflected by
b. External noise neural activity somewhere in the brain, that
c. Internal response determines the doctor’s impression about
d. Uncertainty whether a tumor is present.”

54. The branch of psychology that deals with the 57. A prisoner who has been in solitary confine-
relationships between physical stimuli (i.e., the ment is released back into the general popula-
film) and mental phenomena (i.e., the doctor’s tion four days early due to good behavior.
internal processing of what is seen on the film) Which type of conditioning is being used in
is which of the following? this case?
a. Psychophysics a. Extinction
b. Gestalt psychology b. Classical conditioning
c. Neuroscience c. Negative reinforcement
d. Cognitive psychology d. Positive reinforcement

79
 –M C AT ® E X A M P R A C T I C E T E S T 1–

58. An adult who has a caregiver, such as a family Part 4: Critical Analysis
member, is exhibiting signs of withdrawal from and Reasoning skills
social activities, lack of alertness, bruises, and
frequent arguments with his caregiver. He is 53 Questions
MOST likely exhibiting signs of 90 Minutes
a. multiple sclerosis.
b. elder abuse. Use the following passage to answer questions 1
c. Parkinson’s disease. through 6.
d. Alzheimer’s disease.
(1) In order to understand the social and dynamic
59. Which of the following BEST takes the view significance of modern dramatic art it is
that people become criminals when character- necessary, I believe, to ascertain the difference
ized as such and when they accept the charac- between the functions of art for art’s sake and
terization as a personal identity? art as the mirror of life.
a. Differential association (2) Art for art’s sake presupposes an attitude
b. Strain theory of aloofness on the part of the artist toward the
c. Labeling theory complex struggle of life: he must rise above the
d. Behaviorism ebb and tide of life. He is to be merely an
artistic conjurer of beautiful forms, a creator of
pure fancy.
(3) That is not the attitude of modern art,
which is preeminently the reflex, the mirror of
life. The artist, being a part of life, cannot
detach himself from the events and occurrences
that pass panorama-like before his eyes,
impressing themselves upon his emotional and
intellectual vision.
(4) The modern artist is, in the words of
August Strindberg, “a lay preacher popularizing
the pressing questions of his time.” Not
necessarily because his aim is to proselytize, but
because he can best express himself by being
true to life.
(5) Millet, Meunier, Turgenev, Dostoyevsky,
Emerson, Walt Whitman, Tolstoy, Ibsen,
Strindberg, Hauptmann and a host of others
mirror in their work as much of the spiritual
and social revolt as is expressed by the most
fiery speech of the propagandist. And more
important still, they compel far greater
attention. Their creative genius, imbued with

80
 –M C AT ® E X A M P R A C T I C E T E S T 1–

the spirit of sincerity and truth, strikes root 1. The passage’s central thesis is that
where the ordinary word often falls on barren a. modern European drama is superior to
soil. modern American drama.
(6) The reason that many radicals as well as b. radical and conservative political thinkers
conservatives fail to grasp the powerful message need more creativity.
of art is perhaps not far to seek. The average c. modern drama has the power to evoke
radical is as hidebound by mere terms as the political change.
man devoid of all ideas. “Bloated plutocrats,” d. art for art’s sake is an aesthetic movement
“economic determinism,” “class consciousness,” devoid of meaning.
and similar expressions sum up for him the
symbols of revolt. But since art speaks a 2. What is the closest meaning of the phrase
language of its own, a language embracing the “soapbox orator” (paragraph 7)?
entire gamut of human emotions, it often a. A person who gives improvised political
sounds meaningless to those whose hearing has speeches
been dulled by the din of stereotyped phrases. b. A person of short stature who needs to stand
(7) On the other hand, the conservative sees on a box to get attention
danger only in the advocacy of the Red Flag. He c. A person whose eloquence is considered
has too long been fed on the historic legend pure
that it is only the “rabble” which makes d. A person who advocates the need for
revolutions, and not those who wield the brush cleanliness in society
or pen. It is therefore legitimate to applaud the
artist and hound the rabble. Both radical and 3. Emma Goldman’s statement about how Euro-
conservative have to learn that any mode of pean drama has been “inaccessible in printed
creative work, which with true perception form” (paragraph 8) to the average American
portrays social wrongs earnestly and boldly, theatergoer most likely implies that
may be a greater menace to our social fabric a. Goldman wrote this before the advent of the
and a more powerful inspiration than the Internet.
wildest harangue of the soapbox orator. b. Americans never travel to Europe to see
(8) Unfortunately, we in America have so far great theater.
looked upon the theater as a place of c. Americans have yet to experience the power
amusement only, exclusive of ideas and of a political message in dramatic art.
inspiration. Because the modern drama of d. the average American would rather attend
Europe has until recently been inaccessible in the theater than read a play.
printed form to the average theatergoer in this
country, he had to content himself with the
interpretation, or rather misinterpretation, of
our dramatic critics. As a result the social
significance of the Modern Drama has well
nigh been lost to the general public.
—Emma Goldman, The Social Significance of
the Modern Drama

81
 –M C AT ® E X A M P R A C T I C E T E S T 1–

4. Goldman uses the phrases “bloated plutocrats,” Use the following passage to answer questions 7
“economic determinism,” and “class conscious- through 12.
ness” (paragraph 6) in order to
a. enumerate the ideals that ought to be the (1) Since Gertrude Stein’s work was first
true cause of art. brought to my attention I have been thinking of
b. provide examples of phrases that discuss it as the most important pioneer work done in
social revolt but do not stir emotion. the field of letters in my time. The loud guffaws
c. show examples of the symbolism of revolt in of the general public that must inevitably
the plays of Strindberg. follow the bringing forward of more of her
d. provide examples of phrases that are devoid work do not irritate me but I would like it if
of ideas. writers, and particularly young writers, would
come to understand a little what she is trying to
5. The painter James McNeill Whistler once do and what she is in my opinion doing.
wrote, “Art should be independent of all clap- (2) My thought in the matter is something
trap—should stand alone, and appeal to the like this—that every artist working with words
artistic sense of eye or ear, without confound- as his medium, must at times be profoundly
ing this with emotions entirely foreign to it, as irritated by what seems the limitations of his
devotion, pity, love, patriotism, and the like.” medium. What things does he not wish to
Based on the passage, which of the following create with words! There is the mind of the
statements most closely resembles how the reader before him and he would like to create in
author would respond to Whistler? that reader’s mind a whole new world of
a. Emotion isn’t foreign to art; in fact, it is an sensations, or rather one might better say he
inherent quality in the language of modern would like to call back into life all of the dead
art. and sleeping senses.
b. The artist’s intention is irrelevant; the viewer (3) There is a thing one might call “the
decides the message. extension of the province of his art” one wants
c. Dramatic art is more complex than painting to achieve. One works with words and one
and usually has something to say about life. would like words that have a taste on the lips,
d. Radical and conservative politicians should that have a perfume to the nostrils, rattling
be independent of all clap-trap. words one can throw into a box and shake,
making a sharp, jingling sound, words that,
6. According to the passage, which of the follow- when seen on the printed page, have a distinct
ing would have the most effective political arresting effect upon the eye, words that when
message? they jump out from under the pen one may feel
a. A bumper sticker that contains the poet Walt with the fingers as one might caress the cheeks
Whitman’s phrase “Resist much, obey little.” of his beloved.
b. A television advertisement that includes (4) And what I think is that these books of
famous Broadway actors Gertrude Stein’s do in a very real sense recreate
c. A sermon by Dr. Martin Luther King, Jr. life in words.
d. A painting by Banksy, the graffiti artist/
political activist

82
 –M C AT ® E X A M P R A C T I C E T E S T 1–

(5) We writers are, you see, all in such a hurry. 7. Which of the following choices best explain
There are such grand things we must do. For what Sherwood Anderson means by the
one thing the Great American Novel must be statement that Stein lives among “the little
written and there is the American or English housekeeping words, the swaggering bullying
Stage that must be uplifted by our very street-corner words”?
important contributions, to say nothing of the a. She is not paid well for her writing.
epic poems, sonnets to my lady’s eyes, and b. She writes in plain yet forceful everyday
whatnot. We are all busy getting these grand language.
and important thoughts and emotions into the c. She writes about subjects like street bullying
pages of printed books. and housekeeping.
(6) And in the meantime the little words, that d. She is the voice of the downtrodden.
are the soldiers with which we great generals
must make our conquests, are neglected. 8. Judging from the context, the “loud guffaws”
(7) There is a city of English and American that Anderson refers to in paragraph 1 most
words and it has been a neglected city. Strong likely imply that
broad shouldered words, that should be a. the general public would be delighted to
marching across open fields under the blue sky, read more of Stein’s work.
are clerking in little dusty dry goods stores, b. the general public mocks Stein’s work
young virgin words are being allowed to because they do not understand its
consort with whores, learned words have been significance.
put to the ditch digger’s trade. Only yesterday I c. Stein writes comical poems.
saw a word that once called a whole nation to d. Stein writes for writers and not the general
arms serving in the mean capacity of public.
advertising laundry soap.
(8) For me the work of Gertrude Stein 9. Anderson discusses a writer’s irritation with
consists in a rebuilding, an entire new recasting the “limitations of his medium” (paragraph 2)
of life, in the city of words. Here is one artist most likely to emphasize that
who has been able to accept ridicule, who has a. writing is difficult on its own but Stein also
even forgone the privilege of writing the great has to endure criticism of her work.
American novel, uplifting our English speaking b. Stein breaks the limitations of the medium
stage, and wearing the bays of the great poets, by recasting plain words in a new way.
to go live among the little housekeeping words, c. Stein’s work cannot accurately be captured
the swaggering bullying street-corner words, in prose.
the honest working, money saving words, and d. multimedia work would create a more
all the other forgotten and neglected citizens of complex literature in society.
the sacred and half forgotten city.
—Sherwood Anderson, foreword to Geography
and Plays by Gertrude Stein

83
 –M C AT ® E X A M P R A C T I C E T E S T 1–

10. Based on the information in the passage, which 12. Based on the information in the passage, with
of the following lines of poetry most closely which of the following attitudes in literary crit-
match Anderson’s description of Gertrude icism is Sherwood Anderson most likely to
Stein’s work? agree?
a. “Apple plum, carpet steak, seed clam, a. In order to truly understand a writer’s
colored wine, calm seen, cold cream.” poetry, the reader must know something
b. “My mistress’ eyes are nothing like the sun; about the poet’s life.
Coral is far more red than her lips’ red.” b. A poem does not require beauty, meaning,
c. “Keep, ancient lands, your storied pomp!” or any traditional structure, but it should be
cries she with silent lips. “Give me your tired, an experience of language for its reader.
your poor, your huddled masses yearning to c. The reader must make meaning out of a
breathe free.” poem, regardless of the poet’s intended
d. “Exultation is the going of an inland soul to meaning.
sea—Past the houses, past the headlands, d. In order to understand the meaning of a
Into deep eternity!” poem, the reader has to closely examine its
structure.
11. Which of the following criticisms of Stein
might Anderson be responding to? Use the following passage to answer questions 13
a. Stein’s poetry is just a lot of words strung through 18.
together, omitting sentence structure,
omitting sense—it is like a facile grocery list. (1) Authors of the highest eminence seem to be
b. Stein’s poetry suffers because of its overuse fully satisfied with the view that each species
of rhyme and formal gimmicks. has been independently created. To my mind it
c. Stein’s poetry mixes high and low cultures, accords better with what we know of the laws
the elegant and the vulgar; it is a mongrel. impressed on matter by the Creator, that the
d. Stein’s poetry relies too heavily on the production and extinction of the past and
Romantics. present inhabitants of the world should have
been due to secondary causes, like those
determining the birth and death of the
individual. When I view all beings not as special
creations, but as the lineal descendants of some
few beings which lived long before the first bed
of the Silurian system was deposited, they seem
to me to become ennobled. Judging from the
past, we may safely infer that not one living
species will transmit its unaltered likeness to a
distant futurity. And of the species now living
very few will transmit progeny of any kind to a
far distant futurity; for the manner in which all
organic beings are grouped, shows that the
greater number of species of each genus, and all

84
 –M C AT ® E X A M P R A C T I C E T E S T 1–

the species of many genera, have left no conceiving, namely, the production of the
descendants, but have become utterly extinct. higher animals, directly follows. There is
We can so far take a prophetic glance into grandeur in this view of life, with its several
futurity as to foretell that it will be the common powers, having been originally breathed into a
and widely-spread species, belonging to the few forms or into one; and that, whilst this
larger and dominant groups, which will planet has gone cycling on according to the
ultimately prevail and procreate new and fixed law of gravity, from so simple a beginning
dominant species. As all the living forms of life endless forms most beautiful and most
are the lineal descendants of those which lived wonderful have been, and are being, evolved.
long before the Silurian epoch, we may feel —Charles Darwin, Origin of Species
certain that the ordinary succession by
generation has never once been broken, and 13. Which of the following best captures the main
that no cataclysm has desolated the whole goal of the passage?
world. Hence we may look with some a. To dispute authors who view species as
confidence to a secure future of equally having been independently created
inappreciable length. And as natural selection b. To describe the effects of gravity over time
works solely by and for the good of each being, on various species
all corporeal and mental endowments will tend c. To portray the beauty and perfection of all
to progress towards perfection. living things
(2) It is interesting to contemplate an d. To theorize how the multitude of life as it
entangled bank, clothed with many plants of presently exists on the planet arose
many kinds, with birds singing on the bushes,
with various insects flitting about, and with 14. Darwin’s use of the words “ennobled” (first
worms crawling through the damp earth, and paragraph) and “grandeur” (second paragraph)
to reflect that these elaborately constructed is most likely an attempt to
forms, so different from each other, and a. suggest all living beings originated from
dependent on each other in so complex a divine creation.
manner, have all been produced by laws acting b. highlight that nature is a product of savagery
around us. These laws, taken in the largest in the survival of the fittest.
sense, being Growth with Reproduction; c. advocate that all living forms currently in
Inheritance which is almost implied by existence are in their most perfect state.
reproduction; Variability from the indirect and d. emphasize a sense of awe for the intricacies
direct action of the external conditions of life, and interplay inherent in the process of
and from use and disuse; a Ratio of Increase so evolution.
high as to lead to a Struggle for Life, and as a
consequence to Natural Selection, entailing
Divergence of Character and the Extinction of
less-improved forms. Thus, from the war of
nature, from famine and death, the most
exalted object which we are capable of

85
 –M C AT ® E X A M P R A C T I C E T E S T 1–

15. “Thus, from the war of nature, from famine 17. If, as Richard Dawkins proposes in The Selfish
and death, the most exalted object which we Gene, ideas propagate in society and evolve by
are capable of conceiving, namely, the produc- a process of natural selection, then which of
tion of the higher animals, directly follows.” the following statements is best supported by
the description of the process of natural selec-
Which is the most logical implication of this
tion within the passage?
passage excerpt?
a. Ideas are independently created within the
a. Humankind is not capable of conceiving a brain of an individual.
being greater than itself. b. Weak ideas fall into disuse as stronger ideas
b. There is irony in natural selection because win out and are reproduced throughout
good things arise from bad. society.
c. The most exalted object we are capable of c. We can infer from ideas in the past that no
conceiving is a predator. currently accepted ideas will survive in the
d. War in human society is perfectly natural far-distant future.
and is a product of evolution. d. All ideas are descended from one or a few
original ideas.
16. If Darwin had been aware of contemporary
genetic science, he would most likely agree that 18. Which of the assertions regarding endangered
futurity would contain species that arise from species is a statement with which Darwin
which of the following? would most probably agree?
a. The work of scientists in the field of genetic a. The protection of endangered species is one
modification who seek to create a more of society’s most important moral
perfect species obligations.
b. Mutations in the DNA of embryos that lead b. Endangered species are a rare and beautiful
to radical transformations in the species’ byproduct of natural selection.
appearance or abilities c. Species that are endangered today will not
c. Only large and dominant species that share likely survive to a distant future.
DNA with current predator species like lions d. Human interference with the natural world
and sharks is the main cause of endangered species.
d. A new set of species that develop through
small genetic variance in genomes from Use the following passage to answer questions 19
present-day species over many generations through 24.

(1) It is said that Mirabeau took to highway

robbery “to ascertain what degree of resolution
was necessary in order to place one’s self in
formal opposition to the most sacred laws of
society.” He declared that “a soldier who fights
in the ranks does not require half so much
courage as a footpad”—“that honor and
religion have never stood in the way of a

86
 –M C AT ® E X A M P R A C T I C E T E S T 1–

well-considered and a firm resolve.” This was boundary; new, universal, and more liberal laws
manly, as the world goes; and yet it was idle, if will begin to establish themselves around and
not desperate. A saner man would have found within him; or the old laws be expanded, and
himself often enough “in formal opposition” to interpreted in his favor in a more liberal sense,
what are deemed “the most sacred laws of soci- and he will live with the license of a higher
ety,” through obedience to yet more sacred laws, order of beings. In proportion as he simplifies
and so have tested his resolution without going his life, the laws of the universe will appear less
out of his way. It is not for a man to put himself complex, and solitude will not be solitude, nor
in such an attitude to society, but to maintain poverty, nor weakness. If you have built castles
himself in whatever attitude he find himself in the air, your work need not be lost; that is
through obedience to the laws of his being, where they should be. Now put the foundations
which will never be one of opposition to a just under them.
government, if he should chance to meet with —Henry David Thoreau, Walden: Or Life in
such. the Woods
(2) I left the woods for as good a reason as I
went there. Perhaps it seemed to me that I had 19. Which of the following best captures the main
several more lives to live, and could not spare goal of Thoreau in this passage?
any more time for that one. It is remarkable a. To dissect Mirabeau’s flawed reasoning when
how easily and insensibly we fall into a it comes to society’s most sacred laws
particular route, and make a beaten track for b. To explain the author’s personal reasons for
ourselves. I had not lived there a week before leaving the woods for a sea voyage
my feet wore a path from my door to the pond- c. To point out that a government that is just is
side; and though it is five or six years since I a rarity and that therefore laws are rarely just
trod it, it is still quite distinct. It is true, I fear, d. To emphasize that one should be governed
that others may have fallen into it, and so by one’s own personal truth
helped to keep it open. The surface of the earth
is soft and impressible by the feet of men; and 20. When Thoreau writes “The surface of the earth
so with the paths which the mind travels. How is soft and impressible by the feet of men; and
worn and dusty, then, must be the highways of so with the paths which the mind travels,” the
the world, how deep the ruts of tradition and earth metaphor mostly likely implies that
conformity! I did not wish to take a cabin a. people do not often think outside the box
passage, but rather to go before the mast and because they evolved on a soft earth.
on the deck of the world, for there I could best b. minds are impressionable, malleable, and
see the moonlight amid the mountains. I do subject to conformity.
not wish to go below now. d. neural pathways in the brain do not differ
(3) I learned this, at least, by my experiment: much between different societies.
that if one advances confidently in the direction d. men who follow traditions have soft minds.
of his dreams, and endeavors to live the life
which he has imagined, he will meet with a
success unexpected in common hours. He will
put some things behind, will pass an invisible

87
 –M C AT ® E X A M P R A C T I C E T E S T 1–

21. Mirabeau was an early leader of the French 24. Based on the information in the passage, with
Revolution. Thoreau employs Mirabeau’s which of the following statements about the
quote, “a soldier who fights in the ranks does individual would Thoreau most likely agree?
not require half so much courage as a foot- a. The individual begins as a blank slate and is
pad,”* in order to argue that shaped by experience.
*A footpad is a thief who robs pedestrians. b. The individual is a collection of chemicals
subject to his or her own DNA.
a. militaries can be used for cowardly and c. The individual must create his or her own
nefarious purposes. value system rather than follow an external
b. Mirabeau created an apt metaphor because socially imposed code.
footpads are not courageous. d. The individual as a whole is an illusion but
c. one ought not be defined by his acts of actually consists of distinct yet
disobedience to others but by his obedience interconnected thought processes.
to the laws of his own nature.
d. being told what to do and following orders Use the following passage to answer questions 25
do not require courage. through 30.

22. Based on the discussion in the first paragraph When one has been wandering for a whole morning
of the passage, Thoreau would most likely through a valley of perfect silence, where everything
agree with which of the following acts of around, which is motionless, is colossal, and
disobedience? everything which has motion, resistless; where the
a. A civil rights activist’s refusal to give up her strength and the glory of nature are principally
seat on a bus, in defiance of segregation laws developed in the very forces which feed upon her
b. A hungry man’s decision to steal a loaf of majesty; and where, in the midst of mightiness which
bread seems imperishable, all that is indeed eternal is the
c. A driver who disobeys the speed limit influence of desolation; one is apt to be surprised,
because he enjoys going fast and by no means agreeably, to find, crouched behind
d. A banker’s exploitation of loopholes in some projecting rock, a piece of architecture which is
financial laws neat in the extreme, though in the midst of wildness,
weak in the midst of strength, contemptible in the
23. Based on Thoreau’s attitudes as expressed in midst of immensity. There is something offensive in
the passage, if he were to go on a sea voyage, he its neatness: for the wood is almost always perfectly
would most likely perform which of the fol- clean, and looks as if it had just been cut; it is
lowing actions? consequently raw in its color, and destitute of all
a. Revel in the sights and experiences of the variety of tone. This is especially disagreeable, when
voyage the eye has been previously accustomed to, and finds,
b. Disobey the captain’s orders and climb the everywhere around, the exquisite mingling of color,
ship’s mast just to show his resolve and confused, though perpetually graceful, forms, by
c. Stay below deck and keep to himself which the details of mountain scenery are peculiarly
d. Jump ship because it is unconventional distinguished. Every fragment of rock is finished in

88
 –M C AT ® E X A M P R A C T I C E T E S T 1–

its effect, tinted with thousands of pale lichens and 25. What is the passage’s central thesis?
fresh mosses; every pine tree is warm with the life of a. Neatness in architecture is contemptible.
various vegetation; every grassy bank glowing with b. Architecture should be in harmony with its
mellowed color, and waving with delicate leafage. surroundings.
How, then, can the contrast be otherwise than c. The stamp of human civilization on nature
painful, between this perfect loveliness, and the dead, is offensive.
raw, lifeless surface of the deal boards of the cottage. d. A beautiful piece of architecture cannot
Its weakness is pitiable; for, though there is always compare to the beauty of nature.
evidence of considerable strength on close
examination, there is no effect of strength: the real 26. Judging from the context, the phrase “it is like a
thickness of the logs is concealed by the cutting and child’s toy let fall accidentally on the hillside”
carving of their exposed surfaces; and even what is most likely implies that
seen is felt to be so utterly contemptible, when a. the cottage is dilapidated and in need of
opposed to the destructive forces which are in repair.
operation around, that the feelings are irritated at the b. the creator of the cottage was not a serious
imagined audacity of the inanimate object, with the architect.
self-conceit of its impotence; and, finally, the eye is d. the cottage looks very small and out of place.
offended at its want of size. It does not, as might be d. viewers have a wondrous childlike
at first supposed, enhance the sublimity of fascination with the cottage.
surrounding scenery by its littleness, for it provokes
no comparison; and there must be proportion 27. Ruskin mentions the Parthenon, the Pyramid
between objects, or they cannot be compared. If the of Cheops, and St. Peter’s in order to show that
Parthenon, or the Pyramid of Cheops, or St. Peter’s, a. the magnitude of the Alps can only be
were placed in the same situation, the mind would matched by a magnificent building.
first form a just estimate of the magnificence of the b. great architecture is more likely found in
building, and then be trebly impressed with the size cities.
of the masses which overwhelmed it. The c. there has been a decline in modern
architecture would not lose, and the crags would architecture.
gain, by the juxtaposition; but the cottage, which d. buildings made of stone are more lasting
must be felt to be a thing which the weakest stream and pleasing to the eye than wood
of the Alps could toss down before it like a foam- construction.
globe, is offensively contemptible: it is like a child’s
toy let fall accidentally on the hillside; it does not
unite with the scene; it is not content to sink into a
quiet corner, and personify humility and peace; but it
draws attention upon itself by its pretension to
decoration, while its decorations themselves cannot
bear examination, because they are useless,
unmeaning and incongruous.
—John Ruskin, Poetry of Architecture

89
 –M C AT ® E X A M P R A C T I C E T E S T 1–

28. Which of the following buildings would Use the following passage to answer questions 31
Ruskin consider offensive, according to his through 36.
views as expressed in the passage?
a. A McDonald’s in Times Square (1) Freud’s theories are anything but theoretical.
b. A skyscraper at the end of a country lane He was moved by the fact that there always
c. Pyramids in the desert seemed to be a close connection between his
d. A castle in the Alps patients’ dreams and their mental
abnormalities, to collect thousands of dreams
29. Which of the following statements would and to compare them with the case histories in
Ruskin most likely offer as advice to an archi- his possession. He did not start out with a
tect early in his career? preconceived bias, hoping to find evidence
a. Have thick skin because your architecture which might support his views. He looked at
will be criticized. facts a thousand times “until they began to tell
b. Do not treat your architectural projects like him something.” His attitude toward dream
children’s toys. study was, in other words, that of a statistician
c. Do not build cottages on hillsides. who does not know, and has no means of
d. Create buildings that harmonize with their foreseeing, what conclusions will be forced on
surroundings. him by the information he is gathering, but
who is fully prepared to accept those
30. Based on the discussion in the passage, which unavoidable conclusions.
of the following statements made by famed (2) This was indeed a novel way in
architect Frank Lloyd Wright would Ruskin psychology. Psychologists had always been wont
most closely agree with? to build, in what Bleuler calls “autistic ways,”
a. “All artistic creation has its own philosophy. that is through methods in no ways supported
It is the first condition of creation.” by evidence, some attractive hypothesis, which
b. “No house should ever be on a hill or on sprung from their brain, like Minerva from
anything. It should be of the hill. Belonging Jove’s brain, fully armed. After which, they
to it. Hill and house should live together would stretch upon that unyielding frame the
each the happier for the other.” hide of a reality which they had previously
c. “All materials may be beautiful, their beauty killed. It is only to minds suffering from the
much or entirely depending upon how well same distortions, to minds also autistically
they are used by the architect.” inclined, that those empty, artificial structures
d. “A wood building will look like none other, appear acceptable molds for philosophic
for it will glorify the stick. A steel and glass thinking. The pragmatic view that “truth is
building could not possibly look like what works” had not been as yet expressed
anything but itself. It will glorify steel and when Freud published his revolutionary views
glass.” on the psychology of dreams.
(3) Five facts of first magnitude were made
obvious to the world by his interpretation of
dreams. First of all, Freud pointed out a
constant connection between some part of
every dream and some detail of the dreamer’s

90
 –M C AT ® E X A M P R A C T I C E T E S T 1–

life during the previous waking state. This theory of dreams, neither Jung’s “energic
positively establishes a relation between theory,” nor Adler’s theory of “organ inferiority
sleeping states and waking states and disposes and compensation,” nor Kempf ’s “dynamic
of the widely prevalent view that dreams are mechanism” might have been formulated.
purely nonsensical phenomena coming from Freud is the father of modern abnormal
nowhere and leading nowhere. Secondly, Freud, psychology and he established the
after studying the dreamer’s life and modes of psychoanalytical point of view.
thought, after noting down all his mannerisms —Andre Tridon, introduction to Freud’s Dream
and the apparently insignificant details of his Psychology: Psychoanalysis for Beginners
conduct which reveal his secret thoughts, came
to the conclusion that there was in every dream 31. According to the passage, which of the
the attempted or successful gratification of following statements accord with Freud’s
some wish, conscious or unconscious. Thirdly, theories of dream psychology?
he proved that many of our dream visions are
I. Dreams fulfill a wish, whether the
symbolical, which causes us to consider them as
sleeper is aware of that wish or not.
absurd and unintelligible; the universality of
II. Symbolic actions in sleep mirror
those symbols, however, makes them very
symbolic actions of the insane.
transparent to the trained observer. Fourthly,
III. Dreams are made up of symbols whose
Freud showed that sexual desires play an
meaning may not be apparent to the
enormous part in our unconscious, a part
dreamer.
which puritanical hypocrisy has always tried to
minimize, if not to ignore entirely. Finally, a. I only
Freud established a direct connection between b. III only
dreams and insanity, between the symbolic c. I and II only
visions of our sleep and the symbolic actions of d. I, II, and III
the mentally deranged. There were, of course,
many other observations which Freud made 32. Judging from the context, the term “autistic
while dissecting the dreams of his patients, but ways” (paragraph 2) most likely refers to the
not all of them present as much interest as the psychologists’ methods as
foregoing nor were they as revolutionary or a. characterized by emotional detachment.
likely to wield as much influence on modern b. plagued by impaired communication.
psychiatry. c. not based on observed information.
(4) Other explorers have struck the path d. shortsighted and narcissistic.
blazed by Freud leading into man’s
unconscious. Jung of Zurich, Adler of Vienna
and Kempf of Washington, D.C., have made to
the study of the unconscious, contributions
which have brought that study into fields which
Freud himself never dreamt of invading. One
fact which cannot be too emphatically stated,
however, is that but for Freud’s wish fulfillment

91
 –M C AT ® E X A M P R A C T I C E T E S T 1–

33. Which of the following best expresses the rela- 35. Which of the following statements critical of
tionship between the reference to the Roman Freud does the opening paragraph of the pas-
goddess Minerva and the stretched “hide of a sage most nearly respond to?
reality” (paragraph 2)? a. Freud’s personal concern with his own
a. Minerva, the goddess of war, kills by dreams of castration caused him to search
skinning her victims. for evidence of sexual sublimation in his
b. The “birth” of some psychologists’ theories patients’ dreams.
led to the “death” of reality. b. Interpretation of dream symbols was not
c. Psychologists considered themselves godlike, invented by Freud; in fact, not much of his
so reality was open to interpretation. dream theory can be called original.
d. An idea can spring from the brain with full c. Freud did not accept any criticism of his
force but gets weakened upon further work and he is therefore unscientific.
reflection. d. Freud frequently used cocaine for migraines,
which affected his ability to accurately
34. Which of the following is the most incisive interpret the facts of his patients’ ailments.
criticism of Tridon’s statement that Freud
“looked at facts a thousand times ‘until they 36. If three people all wake up from similar dreams
began to tell him something’”? of being late for a meeting and finding that
a. This statement is unconvincing because it they are naked when they get there, which of
does not appeal to the reader’s emotions. the following statements is the most logical
b. The statement is unconvincing because the conclusion to make according to Freud’s theo-
author is trying to defend Freud by quoting ries as outlined in the passage?
Freud himself. a. The three dreamers all suffer from the same
c. This statement is unconvincing because it mental disorder.
still sounds like Freud could have made up b. The three dreamers all have an unconscious
his whole theory. wish to be exhibitionists.
d. This statement is unconvincing because the c. The three dreamers are all having similar
phrase “a thousand times” is not literally conflicts in their daily lives.
true, sounds unspecific, and does not seem d. The three dreamers are psychically
like a factual piece of evidence. connected to each other.

Use the following passage to answer questions 37

through 41.

(1) The first glimpse we have that the Greeks

possessed an idea of the shape of the earth
comes from the poems of Homer. These poems
show an intimate knowledge of Northern
Greece and of the western coasts of Asia Minor,
some acquaintance with Egypt, Cyprus, and
Sicily; but all the rest, even of the Eastern

92
 –M C AT ® E X A M P R A C T I C E T E S T 1–

Mediterranean, is only vaguely conceived by their ideas of the surrounding ocean from the
their author. Where he does not know he Babylonians.
imagines, and some of his imaginings have had (3) It was after the period of Homer and
a most important influence upon the progress Hesiod that the first great expansion of Greek
of geographical knowledge. Thus he conceives knowledge about the world began, through
of the world as being a sort of flat shield, with extensive colonization which was carried out by
an extremely wide river surrounding it, known the Greeks around the Eastern Mediterranean.
as Ocean. The center of this shield was at Even to this day the natives of the southern part
Delphi, which was regarded as the “navel” of of Italy speak a Greek dialect, owing to the wide
the inhabited world. According to Hesiod, who extent of Greek colonies in that country, which
came after Homer, up in the far north were used to be called “Magna Grecia,” or “Great
placed a people known as the Hyperboreani, or Greece.” Marseilles was also one of the Greek
those who dwelt at the back of the north wind; colonies (600 B.C.), which, in its turn, sent out
while a corresponding place in the south was other colonies along the Gulf of Lyons. In the
taken by the Abyssinians. All these four East, too, Greek cities were dotted along the
conceptions had an important influence on the coast of the Black Sea, one of which,
views that men had of the world. Homer also Byzantium, was destined to be of world-historic
mentioned the pygmies living in Africa. These importance. So, too, the Greeks created colonies
were regarded as fabulous, until they were in North Africa, and among the islands of the
re-discovered by Dr. Schweinfurth and Mr. Aegean Sea throughout the sixth and fifth
Stanley in the late 19th century. centuries B.C., and in almost every case
(2) It is probable that the Greeks obtained the communication was kept up between the
idea of an all-encircling ocean from the colonies and the mother-country.
Babylonians. Inhabitants of Mesopotamia (4) Now, the one quality which has made the
would find themselves reaching the ocean in Greeks so distinguished in the world’s history
almost any direction in which they travelled— was their curiosity; and it was natural that they
either the Caspian, the Black Sea, the should desire to know, and to put on record,
Mediterranean, or the Persian Gulf. the large amount of information brought to the
Accordingly, the oldest map of the world which mainland of Greece from the innumerable
has been found is one with a cuneiform Greek colonies. But to record geographical
inscription, that represents the plain of knowledge, the first thing that is necessary is a
Mesopotamia with the Euphrates flowing map and accordingly, it is a Greek philosopher
through it, surrounded by two concentric named Anaximander of Miletus, of the sixth
circles, which are named “briny waters.” century B.C., to whom we owe the invention of
Outside these, however, are seven detached map-drawing.
islets, possibly representing the seven zones or —Joseph Jacobs, The Story of Geographical
climates into which the world was divided Discovery: How the World Became Known
according to the ideas of the Babylonians. What
was roughly true of Babylonia did not in any
way match the geographical position of Greece,
and it is therefore probable that they obtained

93
 –M C AT ® E X A M P R A C T I C E T E S T 1–

37. What is the main purpose of this passage? 40. Which of the following statements from the
a. To demonstrate the value of poetry as passage contradict the author’s final sentence?
containing ancient truths a. “the oldest map of the world which has been
b. To show that the Babylonians, not the found is one with a cuneiform inscription”
Greeks, were the true inventors of b. “the one quality which has made the Greeks
mapmaking so distinguished in the world’s history was
c. To denounce Greek colonization of the their curiosity”
Eastern Mediterranean c. “one of which, Byzantium, was destined to
d. To trace the origins of geographical be of world-historic importance”
knowledge of the Greeks d. “thus [Homer] conceives of the world as
being a sort of flat shield, with an extremely
38. Judging from the context, the “navel” men- wide river surrounding it, known as Ocean”
tioned in paragraph 1 could best be described
as 41. Based on the passage information, with which
a. the location where Greek warships were of the following statements about culture and
stored. geography is Jacobs most likely to agree?
b. the lifeline that connected all Greek colonies. a. A war-like culture that colonizes foreign
c. the central point of the world. lands will undoubtedly have the greatest
d. the birthplace of the world. access to geographical information.
b. The richest societies that have the ability to
39. The author mentions the discoveries of Dr. fund explorers will obtain the greatest
Schweinfurth and Mr. Stanley in order to geographical knowledge.
strengthen his argument that c. The curious society that values knowledge
a. fables in various cultures are often based on will venture into the world and gain the
fact. greatest amount of geographical knowledge.
b. countries may be discovered, but people d. A maritime culture is most likely to explore
cannot be. the farthest regions beyond its land and
c. Homer was mistakenly credited for collect the greatest amount of geographical
inventing pygmies. information.
d. elements of geographical knowledge found
in Homer’s work are accurate. Use the following passage to answer questions 42
through 47.

(1) In the search for certainty, it is natural to begin

with our present experiences, and in some
sense, no doubt, knowledge is to be derived
from them. But any statement as to what it is
that our immediate experiences make us know
is very likely to be wrong. It seems to me that I
am now sitting in a chair, at a table of a certain
shape, on which I see sheets of paper with

94
 –M C AT ® E X A M P R A C T I C E T E S T 1–

writing or print. By turning my head I see out (3) For most practical purposes these differ-
of the window buildings and clouds and the ences are unimportant, but to the painter they
sun. I believe that the sun is about ninety-three are all-important: the painter has to unlearn
million miles from the earth; that it is a hot the habit of thinking that things seem to have
globe many times bigger than the earth; that, the color which common sense says they ‘really’
owing to the earth’s rotation, it rises every have, and to learn the habit of seeing things as
morning, and will continue to do so for an they appear. Here we have already the
indefinite time in the future. I believe that, if beginning of one of the distinctions that cause
any other normal person comes into my room, most trouble in philosophy—the distinction
he will see the same chairs and tables and books between ‘appearance’ and ‘reality,’ between what
and papers as I see, and that the table which I things seem to be and what they are. The
see is the same as the table which I feel pressing painter wants to know what things seem to be,
against my arm. All this seems to be so evident the practical man and the philosopher want to
as to be hardly worth stating, except in answer know what they are; but the philosopher’s wish
to a man who doubts whether I know anything. to know this is stronger than the practical
Yet all this may be reasonably doubted, and all man’s, and is more troubled by knowledge as to
of it requires much careful discussion before we the difficulties of answering the question.
can be sure that we have stated it in a form that —Bertrand Russell, Reason and Responsibility:
is wholly true. Readings in Some Basic Problems of
(2) To make our difficulties plain, let us Philosophy
concentrate attention on the table. To the eye it
is oblong, brown and shiny, to the touch it is 42. What is the main purpose of this passage?
smooth and cool and hard; when I tap it, it a. To ascertain the true color of the table
gives out a wooden sound. Any one else who b. To explain the differences between painter’s
sees and feels and hears the table will agree with perceptions and philosopher’s perceptions
this description, so that it might seem as if no c. To discuss the difficulty in distinguishing
difficulty would arise; but as soon as we try to appearance from reality
be more precise our troubles begin. Although I d. To distinguish what is practical from what is
believe that the table is ‘really’ of the same color fantastical
all over, the parts that reflect the light look
much brighter than the other parts, and some 43. According to Russell, no two people will see the
parts look white because of reflected light. I exact same color of the table at the same
know that, if I move, the parts that reflect the moment because
light will be different, so that the apparent a. there is no way of knowing whether what
distribution of colors on the table will change. one person considers brown is the same as
It follows that if several people are looking at another’s experience of the color.
the table at the same moment, no two of them b. the psychological effect of color affects the
will see exactly the same distribution of colors, viewer’s perception.
because no two can see it from exactly the same c. the light will reflect off the table differently
point of view, and any change in the point of from different viewpoints.
view makes some change in the way the light is d. people may be color blind, color deficient, or
reflected. have other neural anomalies affecting their
ability to distinguish color.
95
 –M C AT ® E X A M P R A C T I C E T E S T 1–

44. Russell’s argument is most vulnerable to which 47. Which of the following sentences, if added to
of the following criticisms? the final paragraph, would contradict the
a. He fails to consider the female perspective author’s arguments?
and therefore lacks an entirely different
I. In conclusion, any two people, whether
perception of reality.
painter or philosopher, will have similar
b. He fails to define “normal person,” thus
perceptions of the table; they do not
doubting perception but not the perceiver.
need to be exactly the same to determine
c. His disbelief in his own senses must mean
that something really exists.
his judgment is impaired.
II. The fact is, the human mind can consider
d. He fails to consider quantum mechanics and
a table from a myriad of perspectives.
the “imperceptible” reality of the table.
III. We therefore must conclude that a man
can know something is true without
45. Russell references the precise distance from the
requiring knowledge based on
earth to the sun (paragraph 1) most likely in
indisputable fact.
order to
IV. If we therefore cannot determine a table
a. foreshadow his discussion of how light
really exists, then nothing is certain, even
reflects off a table in the next paragraph.
the very concept of certainty.
b. show that even measurable scientific data is
subject to perception. a. I and III only
c. establish his awareness of scientific b. II only
instruments that could enhance the naked c. III only
eye and therefore create another view of the d. I, II, III, and IV
table.
d. establish the differences between a normal Use the following passage to answer questions 48
perception and an enhanced perception like through 53.
that of the painter’s.
(1) In order to understand the meaning of
46. Considering Russell’s assessment of the table’s dialectical regeneration we must first see clearly
color, which of the following most closely what we mean by dialect. We saw before that
resembles what he might say about the table’s language has no independent substantial
shape? existence. Language exists in man, it lives in
a. The true shape of the table is indeterminable being spoken, it dies with each word that is
unless the viewer is an artist who has pronounced, and is no longer heard. It is a mere
mastered perspective drawing. accident that language should ever have been
b. A practical human will have no interest in reduced to writing, and have been made the
the shape of the table. vehicle of a written literature. Even now the
c. The shape of the table will appear to change largest number of languages have produced no
as the viewer walks around the room. literature. Among the numerous tribes of
d. Because the shape of the table can be Central Asia, Africa, America, and Polynesia,
determined through sight and touch, we can language still lives in its natural state, in a state
be more assured of its shape than its color. of continual combustion; and it is there that we
must go if we wish to gain an insight into the

96
 –M C AT ® E X A M P R A C T I C E T E S T 1–

growth of human speech previous to its being “develop themselves progressively, and the
arrested by any literary interference. more we look backward in the history of
(2) What we are accustomed to call languages, language the smaller is their number, and the
the literary idioms of Greece, and Rome, and less definite their features. All multiplicity arises
India, of Italy, France, and Spain, must be gradually from an original unity.” So it seems,
considered as artificial, rather than as natural indeed, if we build our theories of language
forms of speech. The real and natural life of exclusively on the materials supplied by literary
language is in its dialects, and in spite of the idioms, such as Sanskrit, Greek, Latin, and
tyranny exercised by the classical or literary Gothic. No doubt these are the royal heads in
idioms, the day is still very far off which is to the history of language. But as political history
see the dialects, even of such classical languages ought to be more than a chronicle of royal
as Italian and French, entirely eradicated. About dynasties, so the historian of language ought
twenty of the Italian dialects have been reduced never to lose sight of those lower and popular
to writing, and made known by the press. strata of speech from which these dynasties
Champollion-Figeac reckons the most originally sprang, and by which alone they are
distinguishable dialects of France at fourteen. supported.
The number of modern Greek dialects is —Max Müller, Lectures on the Science
carried by some as high as seventy, and though of Language
many of these are hardly more than local
varieties, yet some, like the Tzaconic, differ 48. Max Müller’s description of a language that
from the literary language as much as Doric lives in a “continual state of combustion” most
differed from Attic. In the island of Lesbos, likely indicates that
villages distant from each other not more than a. the language is dead.
two or three hours have frequently peculiar b. the language is constantly changing.
words of their own, and their own peculiar c. the language is plagued by
pronunciation. miscommunication.
(3) It is a mistake to imagine that dialects are d. the language is explosive.
everywhere corruptions of the literary
language. Even in England, the local patois have 49. Which of the following phrases, as used in the
many forms which are more primitive than the passage, most suggests that Müller has a bias
language of Shakespeare, and the richness of against the prominence of literary language?
their vocabulary surpasses, on many points, a. “independent, substantial existence”
that of the classical writers of any period. (paragraph 1)
Dialects have always been the feeders rather b. “tyranny” (paragraph 2)
than the channels of a literary language; c. “the royal heads” (paragraph 4)
anyhow, they are parallel streams which existed d. “those lower and popular strata”
long before one of them was raised to that (paragraph 4)
temporary eminence which is the result of
literary cultivation.
(4) What Grimm says of the origin of dialects
in general applies only to such as are produced
by phonetic corruption. “Dialects,” he writes

97
 –M C AT ® E X A M P R A C T I C E T E S T 1–

50. Grimm’s argument, quoted in the final para- 53. Which of the following descriptions most
graph, is vulnerable to which of the following closely matches how Müller conceives of dia-
criticisms? lects as discussed in the passage?
a. The theory he posits is merely a copy of a. A tree branch that grows out from a large
evolutionary theory: that all species sprung central trunk
from one original. b. A river in constant motion that feeds into
b. Given the small amount of evidence from and flows out of other rivers
ancient scrolls, it is impossible to determine c. A rock that stands alone, firm and fixed in its
a dialect’s origins. place
c. The theory only applies to “corrupted d. A sand grain, distinct yet indistinguishable
dialects” stemming from languages with a from a larger whole
written record.
d. The theory does not take into account the
copious number of dialects presently
spoken.

51. Müller begins with the term dialectical regener-

ation but never explicitly defines it or returns
to it. Given the rest of the passage discussion,
which of the following most closely matches
what he must mean by this phrase?
a. The practice of transcribing dialects into a
written form
b. The growth of language through dialect
c. The logic behind the rise to prominence of
certain words
d. The corruption of literary languages

52. Someone who agreed with Müller’s character-

ization of how a language grows would most
likely also agree with the idea that
a. linguists should not study dead languages.
b. linguists should not characterize languages
as “corrupt.”
c. linguists should study languages that have
no literature.
d. linguists should not study literature.

98
 –M C AT ® E X A M P R A C T I C E T E S T 1–

Answers 4. b. Blood transfusion can sometimes lead to

increases in hemolysis, and thus extracellular
Part 1: Biological and Biochemical levels of hemoglobin, but this generally
Foundations of Living Systems occurs as a result of a rare allergic reaction.
1. a. The unit k'NO, Ox, which represents NO scav- Hemolysis is a common complication of
enging activity, is the only parameter that liver cirrhosis, inflammatory bowel disease,
directly correlates with the increase in MAP. and malaria infection.
The variants with high k'NO, Ox values are 5. b. The pI of glutamic acid is 3.22 because it has
also associated with greater changes in MAP, two carboxyl groups (and one amino
suggesting that NO scavenging and deple- group). The other amino acids have only
tion are responsible for hypertension. Nei- one carboxyl group (and one amino group)
ther low nor high P50 values, indicating high and consequently have similar pIs in the
and low oxygen affinity, respectively, are range of 6.0. (The pIs of alanine, glycine,
associated with increases in MAP, while and glutamine are 6.00, 5.97, and 5.65,
autoxidation, reflected by kautox, could be respectively.)
due to unstable rHb dimers, but these values 6. b. Lysine is a charged amino acid, and charged
do not correlate with MAP increases. amino acids usually cover the surface of the
2. c. The binding curve of hemoglobin for oxy- protein molecule. Isoleucine, alanine, and
gen is sigmoidal because the protein can proline are hydrophobic amino acids, and
bind oxygen at high concentrations in lungs hydrophobic amino acids are typically bur-
and release it at low concentrations in tis- ied inside the core of the protein molecule.
sues. The mutants in choice a and b have 7. d. Isoprene and myrcene are terpenes that do
high affinity for oxygen under both condi- not contain oxygen. Terpenes are a type of
tions, while the mutant in choice d has a low hydrocarbon terpenoid that all have double
affinity for oxygen under both conditions. bonds and are classified based on the num-
3. b. It is critical to know the DNA sequence of a ber of 5-carbon units they contain (isoprene
gene, specifically the cDNA (complementary rule).
DNA) sequence, to clone it. Expression of 8. c. Certain lipids in bacterial and mammalian
hemoglobin protein in bacteria is incorrect cell membranes are involved in intracellular
because recombinant hemoglobin has also and intercellular signaling. Cholesterol is not
been expressed in yeast (and expressed and present in the membranes of prokaryotes,
purified from pigs). Additionally, the cDNA eukaryote cell membranes do not have nega-
(complementary DNA) sequence is the tively charged lipids on their surface, and
sequence of the gene after splicing has bacterial plasma membranes are often made
occurred, so it is not necessary to know the up of one main type of phospholipid,
splice donor and acceptor sites, and many whereas the plasma membranes of most
genes are cloned and expressed without eukaryotes have a mixture of different
knowing their structure (although the crys- phospholipids.
tal structure of hemoglobin was one of the
first proteins to be solved, in the 1920s).

99
 –M C AT ® E X A M P R A C T I C E T E S T 1–

9. b. The rate of refolding is slower in the pres- 11. a. Chaperones such as Hsp70 and GroEL can
ence of MDH, as indicated by the lower act iteratively on a molar excess of misfolded
amount of refolded Rho at the first five time substrates. The passage states, “chaperones
points in the top four curves, but the con- don’t change the chemical composition of
centration of refolded Rho at the last time their misfolded polypeptide substrates,”
point (60 min) is the same. The rate of while, as stated in the passage, substrates
refolding is slower in the presence of MDH, may end up dissociating from the chaper-
as indicated by the lower amount of refolded one, and it should be clear that ATP is not
Rho at the first five time points in the top required based on the graph; the refolding of
four curves. MDH transiently binds with the Rho could occur, though to a lower level, in
chaperones and competes with Rho. Addi- the absence of ATP (compare the middle
tionally, the graph indicates that MDH does two curves with the top two curves).
not form overly sticky complexes with the 12. c. The passage states that cell stress, such as
chaperones because they are still able to fold heat, can break weak bonds within a protein,
Rho, and the concentration of refolded Rho particularly hydrogen bonds. Covalent
at the last time point (60 min), and thus the bonds are the strongest bonds that are pres-
yield of refolded Rho, is the same in the ent in biochemicals; heat and denaturing
presence of ATP (top two curves) whether agents do not break covalent bonds. Disul-
MDH is present (solid circles) or absent fide and carbon bonds are types of covalent
(open circles). bond; they are typically not disrupted by
10. d. Although phosphotidylinositol-3-kinase is heat.
regulated by chaperones, it does not have 13. d. HEPES is an organic buffering agent that
chaperone activity itself. (Isomerases with can actually increase protein stability and
similar sounding names, peptidyl-prolyl solubility. Urea is a denaturing agent that
cis-trans isomerase and protein disulfide primarily disrupts the hydrogen bonds in a
isomerase), do have chaperone activity.) polypeptide, while extremes of pH, such as
Hsp70 is one of the major chaperone fami- low (acids) or high (detergents), change the
lies in eukaryotes. (In bacteria, it is called net charge on polypeptides and can alter
DnaK.) SecB is a soluble chaperone in bacte- electrostatic and hydrogen bonds, and alco-
ria, and GroEL/GroES is one of the major hol destroys hydrogen bonds between the
chaperone families in bacteria. (In eukary- amide groups in the protein’s secondary
otes, it is called Hsp60/Hsp10.) It should be structure.
easy to eliminate because it is the example in 14. d. According to the model, GroEL has two sub-
the passage. units of hepatemeric rings, so there are 14
rings. If each ring binds to an ATP, there are
14 ATP molecules and thus 14 ADP mole-
cules produced by ATP hydrolysis.

100
 –M C AT ® E X A M P R A C T I C E T E S T 1–

15. a. If an enzyme reacts by the two-step Michaelis- 18. a. The lower value of KD corresponds with
Menten mechanism, Vmax = k[Et], where higher affinity of inhibitor for enzyme (in
Vmax is the maximum rate of the reaction, this case DHFR variants 1–4). 2.2 nM < 9.5
[Et] is the total concentration of enzyme, in nM < 25 nM < 3 × 10–8 M (= 30 nM). These
this case chymotrypsin, and k is either the values are in the range of actual KD for
rate of enzyme-product complex formation DHFR and MTX.
or product release, whichever is lower (i.e., 19. a. DNA strands anneal at physiological con-
rate limiting). In this, as in most cases, the centrations of pH and temperature, which is
rate of product release, not the rate of approximately 1 mM Mg2+ (and also the
enzyme-product complex formation, is lim- recommended concentration for PCR). It is
iting, so Vmax = 1.3 × 10–4/sec × 2 × 10–5 M. recommended to increase the number of
1
Vmax is __ V only when the substrate con-
2 0
cycles and increase the DNA denaturation
centration is equal to Km for the reaction. In temperature to increase PCR yield and to
this case, the substrate concentration is not maintain a balance of nucleotides to increase
given. reaction fidelity.
16. b. In the plot for uncompetitive inhibition, the 20. b. The cell distinguishes the template and the
slope of the lines is the same for the different newly synthesized strand, which is impor-
concentrations of inhibitor (methotrexate). tant for correct mismatches. Alkyl lesions on
In the plot for competitive inhibition, the the nitrogen or oxygen of DNA damage the
slope increases as the concentration of DNA, 5' phosphate groups are important for
inhibitor (methotrexate) increases and the DNA ligation, and acetylation of histone
lines intercept near 1/V, while the plot for groups plays a role in gene activation, not
mixed inhibition is similar to that of com- DNA repair.
petitive inhibition, except the lines intercept 21. a. According to the model of double-strand
before 1/V, and irreversible inhibition is a break repair for homologous genetic recom-
different category of inhibition (competitive, bination, the 3' overhangs invade the homol-
uncompetitive, and mixed are all types of ogous chromosome duplex, pairing with the
reversible inhibition) in which the inhibitor complementary strand and displacing the
binds covalently with or destroys an other strand. The DSBs are repaired after
enzyme’s functional group. this crossover event.
17. c. A competitive inhibitor binds to the active 22. c. The DSB pattern for each strain, as indicated
site of the enzyme and prevents the substrate by the bands on the corresponding Southern
from binding, whereas an uncompetitive blots, is similar. However, there are fewer
inhibitor binds to a site distinct from the bands for rad50+ at 5 and 6 hours than for
enzyme active site and only when the rad50S and swi5∆ rhp57∆, indicating that
enzyme is in a complex with substrate. these mutants did not repair the DSB inter-
mediates. The maximal level of DSBs is in
the rad50+ strain.

101
 –M C AT ® E X A M P R A C T I C E T E S T 1–

23. b. The detection of DNA by Southern blotting 25. c. Eukaryotic cells have two important types of
involves restriction enzyme digest to sepa- repetitive DNA sequences: centromeres and
rate the DNA sample into fragments, separa- telomeres. Only centromeres are required for
tion of the fragments by gel electrophoresis, the even distribution of chromosomes dur-
alkali treatment to denature the DNA, trans- ing mitosis; they link the chromosomes to
fer of the DNA to a membrane, and then spindles via microtubules. Telomeres do,
detection using a labeled (such as radiola- however, play a role in the number of
beled) DNA probe that is complementary to mitotic divisions a cell undergoes and in the
a repeat sequence in the DNA sample. If the recombination of homologous chromo-
amount of DNA sample is low, researchers somes during meiosis. Centromeres and
can amplify the DNA using polymerase telomeres are actually associated with tran-
chain reaction, but this is not a necessary scriptionally inactive chromatin, also known
step. as heterochromatin. The genomes of pro-
24. d. Nucleotide probes can hybridize to RNA karyotes are typically circular and thus do
molecules if they contain complementary not contain telomeres, whereas they do con-
sequences and RNA can be separated by tain centromeres, which sometimes resemble
gel electrophoresis (although in a non- eukaryotic centromeres.
denaturing gel used for DNA, RNA 26. c. FIS is the inbreeding coefficient within
molecules separate in an unpredictable populations, and it is zero if random mating
smear). Although RNA cannot be directly occurs and high if inbreeding occurs. FIT is
amplified by polymerase chain reaction (it a measure of gametes within an individual
requires reverse transcription–polymerase relative to the total population, and FST is
chain reaction to produce cDNA), a measure of random gametes within
amplification is not a necessary step in subpopulations. These values should be
Southern blotting. However, DNA can be equal with each other to agree with the
harvested under conditions that do not Hardy-Weinberg principle.
recover RNA, including the use of enzymes 27. b. Based on the Hardy-Weinberg equation, the
that degrade RNA (RNAses). frequencies of the homozygous dominant
allele (p2), the homozygous recessive allele
(q2), and the heterozygous allele (pq) have to
add up to 1 (p2 + q2 + 2pq =1). In this case,
p2 = 0.48 (48%) and q2 = 0.36 (36%), so 2pq
= 0.16 (16%).
28. c. The consensus gene promoter sequence in
E. coli has an AT-rich region between posi-
tions −40 and −60 (relative to the transcrip-
tion start site), followed by a TTGACA
consensus sequence at −35 (which allows a
high transcription rate), then a TATAAT,
known as the Pribnow box, at −10.

102
 –M C AT ® E X A M P R A C T I C E T E S T 1–

29. c. According to Le Châtelier’s principle, if a 33. d. Naphthalene is a compound with two ben-
chemical reaction is at equilibrium, a change zene-like rings fused together. Analogs of
in conditions that displaces equilibrium will naphthalene can have carbon in the place of
lead to a change toward a new equilibrium. nitrogen at some positions, as is the case for
Injection of CO2(g), which is a gas, would quinoline and purine. Cyclohexane is a
lead to a shift in the equilibrium from left to single ring of six carbons with no double
right, whereas injection of 2CO gas would bonds, benzene is a single ring of six carbons
lead to a shift from right to left. However, with three double bonds, and anthracene is a
addition of C(s), which is a solid, does NOT compound with three benzene-like rings
lead to a shift in the reaction equilibrium if fused together.
the pressure is kept constant because the 34. b. As stated in the passage, IC50 corresponds to
concentration of a solid is independent of the drug concentration that is required to
the amount present. inhibit 50% of the activity of an enzyme, so
30. b. As stated in the passage, glucose is an aldose the lower the IC50, the more active the drug
because it has a carbonyl group (C = O) at is against ALR2, which is the designated tar-
the end of its 6-carbon chain (at C1 in this get. On the other hand, as stated in the pas-
chemical structure representation). Fructose sage, activity against ALR1 has been
belongs to the family of ketoses because its associated with adverse side effects, so the
carbonyl group is within the carbon chain higher IC50 for ALR1 is desirable. The com-
(at C2 in this chemical structure representa- pound with the lowest IC50 for ALR2 and
tion). Both glucose and fructose are hexoses, highest IC50 for ALR1 is compound 6.
but the two families of monosaccharides are 35. a. Changes in compound color can be mea-
considered aldose and ketose. sured using spectrophotometry. Enzyme
31. c. As stated in the passage, glucose is an essen- digest is a technique used for analyzing
tial monosaccharide. It is one of eight essen- DNA, and gel electrophoresis is a technique
tial monosaccharides that need to be for separating nucleic acids. Although color
obtained for proper functioning in humans, changes can be seen by microscopy, this
along with fucose, galactose, mannose, technique is not necessarily quantitative, and
acetylglucosamine, acetylgalactosamine, electron microscopy is generally used for
xylose, and acetyl-neuraminic acid. visualizing subcellular structures.
(Although these sugars can be synthesized, it 36. c. As stated in the passage, miRNAs are nor-
is more efficient to obtain them from diet.) mally expressed in human cells (endogenous
32. b. This choice is incorrect. As stated in the pas- expression), whereas siRNAs are not nor-
sage, tissues such as the lens, kidney, retina, mally expressed in human cells but can be
and peripheral nerves have insulin-indepen- introduced (exogenous expression). In terms
dent uptake of glucose. In contrast, insulin of length, miRNAs are 21 to 23 nucleotides
increases glucose uptake in adipose tissue. long and siRNAs are 22 nucleotides long,
both miRNAs and siRNAs can block transla-
tion and degrade mRNAs, and both pro-
cessed from their precursors—either miRNA
precursors or dsRNAs—by Dicer.

103
 –M C AT ® E X A M P R A C T I C E T E S T 1–

37. b. As stated in the passage, lncRNAs often 42. d. As described in the text, ESCs and FSCs raise
resemble mRNAs and are capped and ethical concerns, as well as concerns about
polyadenylated. mRNAs also contain splice tumor formation and immune rejection.
donor and acceptor sites, as do lncRNAs; Induced pluripotent stem cells could bypass
however, mRNAs are not typically some of these concerns, but they could still
acetylated. carry tumor risk and are difficult to culture.
38. a. As stated in the text, miRNA molecules are On the other hand, ASCs, such as MSCs and
21 to 23 nucleotides, whereas lncRNA are NSCs, have been studied in preclinical and
long and resemble mRNAs. Sequence 1 is an clinical trials for the treatment of neurologi-
miR122; sequence 2 is an lncRNA known as cal disorders.
HOTTIP. 43. d. Although growth factors are probably
39. d. As stated in the text, “[s]everal properties of required for the maintenance and prolifera-
RNAs make them attractive clinical tools, tion of MSCs, it most likely does not have to
including the fact that they can be detected be a specific subset of them. Similar to other
in patient sera, they are stable, and sensitive ASCs, MSCs must be adherent, which can be
detection methods are available, such as reasoned based on the fact that they serve to
microarray and polymerase chain reaction.” replenish cells in environmentally exposed
40. b. Freezing point depression is a colligative epithelial lining tissue. Additionally, popula-
property expressed as T°f − Tf and is equal tions of ASCs can be defined by their bio-
to the colligative molality mc multiplied by markers (cell surface markers), which in the
the freezing point depression constant, Kf, case of MSCs are CD73, CD90, and CD105,
which is 1.86 K mc–1. 0.002 K would actually to name a few, and while MSCs are multipo-
be the boiling point elevation, T°b − Tb, tent and can differentiate into cell types of
which is equal to the colligative molality mc the resident tissue (bone, cartilage, and adi-
multiplied by Kb, which is the boiling point pocytes), they do not necessarily differenti-
elevation constant (0.513 K mc–1); 1.15 K is a ate into neuronal or cardio cells.
random number that does not correspond 44. b. As stated in the passage, MSCs are believed
to any constant; and 3.16 K is a value derived to act via paracrine effects on cells in the
by this equation, by using Henry’s law con- surrounding area instead of triggering
stant [for O2(g) in water at 25 degrees Cel- regeneration of neuronal cells. Paracrine
sius], which is 790 bar M–1. effects include secretion of growth factors,
41. c. As stated in the text, overexpression of cytokines to modulate the immune system,
c-Myc, Sox2, Oct4, and Klf4 can reprogram and anti-apoptotic factors, which have all
somatic cells into a pluripotent state. C-Myc, been reported for MSCs. The passage does
Sox2, Oct4, and Klf4 are all transcription not indicate that stem cells secrete pluripo-
factors. tency-inducing factors, such as c-Myc; nor
have they been found to have that activity.

104
 –M C AT ® E X A M P R A C T I C E T E S T 1–

45. a. As stated in the passage, Staphylococcus is a 50. c. As stated in the passage, POMC is processed
Gram-positive bacteria and Staphylococcus by proteases that cleave in between basic res-
aureus can be distinguished from other idues. Arg and Lys are basic amino acid resi-
Staphylococcus species because it is coagu- dues, Gln is polar, and Asp and Glu are
lase-positive. Staphylococcus bacteria are acidic.
cocci-shaped and aerobic bacteria (and thus 51. b. As stated in the passage, binding of leptin to
catalase-positive). its receptor, Ob-Rb, activates the JAK-STAT
46. d. The bacteria in the first image are spherical pathway. In this canonical signaling pathway,
cells, in the second image are rods, and in binding (in this case of leptin to two recep-
the third image are spiral cells. As stated in tor monomers) leads to dimerization of the
the passage, Streptococcus species are spherical, receptor molecules, followed by phosphory-
whereas E. coli (as well as Salmonella lation of the intracellular regions of the
bongori) are rod-shaped. S. aureus is sphere- receptor dimer. Then the phosphorylated
shaped. Both Treponema pallidum and receptors recruit STAT molecules, which
Borrelia burgdorferi are spiral-shaped. dock, become phosphorylated themselves,
47. c. Based on the description in the passage, the dimerize, and then translocate to the nucleus
bacteria is Gram positive. Bacillus anthracis to finally stimulate gene expression.
is Gram positive, whereas Salmonella bong- 52. d. The top graph is ghrelin, and the bottom
ori, Escherichia coli, and Neisseria meningiti- graph is insulin. As stated in the passage,
des are Gram negative. ghrelin acts on a short time scale and is
48. d. According to Henry’s law, the concentration responsible for feelings of sharp hunger.
of gas in a liquid is equal to the partial pres- Thus, it peaks right before mealtimes. This
sure of that gas, in this gas 1 atm, divided by pattern is in contrast to insulin and leptin,
the Henry’s law constant kh (atm/M) for which repress feelings of hunger and have a
that gas. The concentration for He, N2, O2, longer time scale.
and CO2 is 0.00037 M, 0.00063 M, 0.0013 M, 53. b. NK cells are part of the innate immune sys-
and 0.034 M, respectively. tem, not the adaptive immune system. As
49. b. “POMC neurons are anorexigenic because, can be seen in the graph, NK cells can be
by activating MC4R, they reduce food intake activated by interferons (IFNs) and certain
and increase energy expenditure,” so disrup- cytokines (such as IL-12), the levels of NK
tion of the POMC gene would be expected cells decline as T-cells are produced, and NK
to increase fat accumulation. Additionally, cells help control virus replication in the
the POMC polypeptide is processed into early days of a viral infection, but they do
nine proteins including a-MSH, so disrup- not eliminate the virus.
tion of the POMC gene would be expected 54. d. IgM is the first class of immunoglobulin
to lead to downregulation of a-MSH, and produced after activation of a B cell.
POMC activates MC4R neurons, so disrup-
tion of the POMC gene would be expected
to reduce activation of MC4R neurons.

105
 –M C AT ® E X A M P R A C T I C E T E S T 1–

55. d. As stated in the passage, “fatty acid chains 59. c. The test could not predict AKI on the day of
with more than 14 carbons are more lipo- surgery (point 1 = baseline; point 2 = right
philic than shorter chains, and unsaturated after surgery; point 3 = 4 hours after sur-
fatty acids are more likely to undergo lym- gery) because there was no difference
phatic transport than saturated fatty acids.” between the patients with AKI (light gray
Phosphatidylcholine has a 16-carbon tail, bars) and without AKI (dark gray bars).
choline is a head group alcohol with only However, the morning after surgery (point
five carbon atoms, glycerol is a head group 4), the test is able to predict AKI.
alcohol with only three carbon atoms, and
palmitic acid is a saturated fatty acid. Part 2: Chemical and Physical
56. a. As described in the passage, the inability of a Foundations of Biological Systems
drug to diffuse across the blood vessel endo- 1. b. This choice is correct. The ideal gas law,
thelium can block its uptake into blood ves- PV = nRT, is required for this problem to
sels and encourage lymph uptake because determine the number of moles of air the
lymphatic capillaries are more permeable lungs can hold.
than blood capillaries. Compounds with PV (1 atm)(6.0 L )
n = = = 0.236 mol air
larger molecular weight and colloidal mate-
rials would be less likely to diffuse easily.
RT
( 0.0821 )
L ⋅ atm
mol ⋅ K
(310 K )

Also, as stated in the text, hydrophilic com- Since only 78.1% of the air is nitrogen, this
pounds are primarily taken up by blood number must be multiplied by 0.781. This
vessels. gives an answer of 0.184 moles of nitrogen.
57. b. As stated in the text, CD50 is the concentra- Finally, this number must be converted to
tion of drug at which half of the cells die, so number of molecules using Avogadro’s
the lower the concentration (here in mM) number.
× 1023 molecules
the more toxic the drug. The lowest CD50 is 0.184 mol N2 × 6.022
__________________
1 mol N 2

that of didanosine-derivative 1. = 1.11 × 1023 molecules N2

58. a. Kinesin and dynein are both microtubule This calculation shows that choice a is too
motors, and dynein is involved in slow axo- low, choice d is too high, and choice c would
nal transport. A major difference between be obtained if one failed to multiply the
kinesin- and dynein-based (and myosin- number of moles by 78.1%.
based) cell motility is that AMP-PNP (ade- 2. a. pKa = –log(6.28 × 10–5) = 4.20
[A–]
nylyl-imidodiphosphate) dramatically ____
pH = pKa + log [HA] = 4.20 + log [0.0800 M]
_________
[0.805 M]
inhibits kinesin activity, but it is only a weak = 3.20
inhibitor of dynein, and dynein is involved The Henderson-Hasselbach equation can be
in retrograde axonal transport, whereas used to correctly calculate the pH using the
kinesin is classified as an anterograde axonal information provided. This calculation
transporter. shows that the pH in answers b, c, and d are
too high.

106
 –M C AT ® E X A M P R A C T I C E T E S T 1–

3. b. C2H5OH(l)+3O2(g) → 2CO2(g)+3H2O(l) 4. c. This choice is correct. Chaotropic agents dis-

5.00 mL ethanol × 0.789 g ethanol
____________
1 mL ethanol
1 mol ethanol
× ____________
46.1 g ethanol
rupt hydrogen bond networks by definition,
3 mol H2O 18 g H2O 1 mL H2O and the structure of urea is particularly
× 1___________
mol ethanol
× _________
1 mol H2O
× _________
1 g H2O suited for this purpose. Within the carbonyl
= 4.62 mL water
group, the oxygen has a high electronegativ-
Actual Yield
Percent Yield = ______________
Theoretical Yield
× 100% ity and free electron lone pairs, making it
1.10 mL water
= ____________
4.52 mL water
× 100% = 24.3% very suitable as a hydrogen bond acceptor.
The calculation above uses the volume, den- Additionally, the nitrogens are both electro-
sity, and molar mass of ethanol, the correct negative and can serve as hydrogen bond
mole ratio between ethanol and water, and acceptors, while the hydrogens on the nitro-
the molar mass and density of water to cal- gens are potential hydrogen bond donors.
culate the theoretical yield of water in the Molecules like formaldehyde may disturb
reaction. The percent yield is then calculated the covalent or ionic bonds between mono-
by dividing the actual yield by the theoretical mers, but urea is unlikely to do this. Disul-
yield to find the percent yield for the reac- fide bond breakage is the result of sulfur
tion. Choice a would be obtained if the two reduction. This is commonly caused by such
densities were switched in the calculation; agents as 2-mercaptoethanol and dithioth-
choice c would be obtained if the mole ratio reitol, but the structure of urea contains no
for ethanol and carbon dioxide were used structures likely to accomplish this reaction.
instead of the correct mole ratio for ethanol Finally, Peptide bond hydrolysis can occur in
and water; and choice d would be obtained the presence of water, with 2 to 4 kcal/mol of
if a 1:1 mole ratio were used. free energy released per peptide bond. How-
ever, this process is extremely slow, and no
feature of urea is uniquely suited to speed up
this process.
5. d. For all five tested pH values, the denatur-
ation curve shifts to the right as salt concen-
tration increases. A shift to the right
indicates that a higher concentration of urea
is required to denature the protein, which
suggests increased stability. Therefore,
increased salt concentration appears to sta-
bilize the protein in this experiment.
Increasing salt concentration increases pro-
tein stability at all pH values because the
elliptical curves consistently shift to the right
as salt concentration increases, so there is no
significant difference between salt concen-
tration effects at low and high pH.

107
 –M C AT ® E X A M P R A C T I C E T E S T 1–

6. c. The best buffer selection is the one whose 10. a. Potential Energy = __ 1 2 1
__ N
__
2 kx = 2 (5.0 m )
pKa is within 1 pH unit of the desired pH. (0.75 m – 0.5 m)2 = 0.63 J
The only buffer in the provided table that The calculated number and unit are both
has a pKa within 1 pH unit of the desired pH correct. 1 Joule (J) = 1 Newton (N) × 1
in Figure 1, panel c, is HEPES, which has a meter (m). Choice b would be obtained if
pKa of 7.6. None of the pKa of glycine-HCl, one forgot to subtract 0.5 m from the x
sodium acetate, and ammonium acetate are value, choice c if one used the mass instead
within 1 pH unit of the desired pH of 7. of the change in spring length, and choice d
7. a. When ∆G is positive, the process under if one incorrectly swapped the k and x
investigation is non-spontaneous and values.
requires external energy to occur. Therefore, 11. a. Kinetic energy = __ 1 2
2 mv , so if kinetic energy
an increase in ∆G in this experiment indi- is increasing and mass is constant, velocity
cates increased resistance to denaturation. As must also be increasing. Both the kinetic
pH increases, the elliptical curves shift to the energy and velocity are at their minima
right, indicating increased resistance to when the spring is fully extended and fully
denaturation. This is true for all curves compressed, so if kinetic energy is increas-
where NaCl is present. Therefore, as pH ing, the box must be moving away from
increases, the unfolding ∆G also increases. these positions. If the box is moving to the
Protein stability consistently increases left, its kinetic energy increases as it
throughout the tested pH range, so the ∆G approaches equilibrium and decreases as it
consistently increases. approaches the spring’s most compressed
8. d. The frequency, inversely proportional to state; if the box is moving to the right, its
period, measures how quickly the object is kinetic energy increases as it approaches
oscillating. Velocity is defined as the distance equilibrium and decreases as it approaches
an object travels over a given time frame, the spring’s most extended state.
acceleration is a measure of the change in 12. b. The cathode is the negatively charged termi-
velocity over a given time frame, and the nal where the reduction reaction occurs. The
period is the amount of time it takes for the anode, by definition, is the positively
spring to complete one oscillation cycle. charged terminal and is the location of the
1
9. c. Because potential energy is equal to __ 2
2 kx , oxidation reaction, and the reduction reac-
changes in m do not affect potential energy, tion occurs only at the cathode, not at the
and potential energy stays the same as m anode. As a reduction must be occurring,
increases; additionally, the spring constant answer d cannot be correct.
does not change for a given spring. 13. d. The oxidation number of V changes from 4+
to 5+ over the course of the reaction, so V is
being oxidized. The oxidation number of H
is 1+ in both the reactants and products; Mn
changes from 7+ to 4+ over the course of the
reaction, so Mn is being reduced; and O is
2– in all species in this reaction.

108
 –M C AT ® E X A M P R A C T I C E T E S T 1–

–
14. b. The Lewis structure of MnO4 is shown 15. b. We must begin with the provided
below: half-reactions:
– –
MnO4 + 4H+ + 3e → MnO2 + 2H2O
O
E° = 1.68 V
–
VO2+ + 2H+ + e → VO2+ + H2O E° = 1.00 V
O Mn O– Based on reduction potentials, the first half-
reaction will be the reduction reaction in the
O spontaneous overall reaction. The equation
provided in the question already tells us this.
There are four possible resonance structures,
The second half-reaction must therefore be
with the single bond on each of the four
reversed and multiplied by 3; the reduction
oxygens, but for the purposes of VSEPR
potential must be reversed to –1.00, but it
shapes, these resonance structures are not
should not be multiplied by 3. The equations
particularly important. What is important is
can then be added together to get the overall
that there are no lone pairs on the Mn atom
reaction, and the reduction potentials can
that will influence the shape of the molecule.
also be added together to get E° for the cell:
There are four ligands on Mn, and there are – –
no lone pairs on the central atom. Therefore, MnO4 + 4H+ + 3e → MnO2 + 2H2O
the shape of the molecule is tetrahedral. E° = 1.68 V
–
There are no lone pairs on Mn that would 3VO2+ + 3H2O → VO2+ + 6H+ + 3e
cause the square planar shape. This shape is E° = –1.00 V
___________________________________
–
usually observed when there are four ligands MnO4 + 3VO2+ + H2O → MnO2 + 6H+ +
and two lone pairs on the central atom. Lin- 3VO2+ E° = 0.68 V
ear configurations most commonly occur in Finally, the equation ∆G° = –nFE° is used to
molecules with two ligands on the central calculate ∆G°, keeping in mind that 1 V =
atom. And Seesaw configurations commonly 1 J/C:
occur when there are four ligands and two –
∆G = –nFE° = –(3 mol e )(96,485 ___ c
)
mol
lone electron pairs on a central atom. Since J
__ 5
(0.68 C ) = –1.97x10 J = –197 kJ/mol MnO4
–

there are four ligands and no lone pairs on Choice a would be obtained if one used 1 for
Mn in permanganate, this is not the correct n rather than 3 during the last step, choice c
shape. would be obtained if E° for the oxidation
half-reaction was multiplied by 3 and then 1,
rather than 3, was used for n during the last
step, and choice d would be obtained if E°
for the oxidation half-reaction was multi-
plied by 3 and then everything else was done
correctly.

109
 –M C AT ® E X A M P R A C T I C E T E S T 1–

16. c. Plant cells have cellulose cell walls, so c. 20. c. Oxygen from blood in the capillaries is
reinhardtii does have a cellulose cell wall. distributed to all of the body tissues.
The presence of a cell wall makes lysis more Oxygen-poor tissues have a high
difficult because the purpose of a cell wall is concentration of carbon dioxide, so oxygen
to provide structural stability. There are diffuses from the blood into the interstitial
membrane-bound organelles in c. reinhardtii fluid, but carbon dioxide diffuses from the
because it is an algal cell and therefore is interstitial fluid into the blood, ammonia is
categorized taxonomically in the Plantae a cellular waste product that moves from the
kingdom. However, this feature is not interstitial fluid into the blood, and nitrogen
especially relevant to difficulties with cell does not significantly diffuse out of the
lysis. Fungal cells have chitin cell walls, but c. capillaries for distribution to the body
reinhardtii is a member of the Plantae tissues.
kingdom. Additionally, Plant cells have 21. b. The osmotic pressure is less than the
nuclei. hydrostatic pressure at the arteriole end,
17. b. A free asparagine contains two nitrogen causing fluid to move from the vessel to the
atoms: one in its side chain and one in the body tissue. Alternatively, the osmotic
amine group that forms the peptide bond pressure is greater than the hydrostatic
within a protein. If all 14N atoms are pressure at the venule end, causing fluid,
swapped 15N isotopes, the mass of free carbon dioxide, and other wastes to be
asparagine should increase by 2 amu. drawn from the body tissue into the
18. d. As Figure 1 indicates, the Rt value is indeed capillary vessel. Toward the middle of the
the fraction of total free amino acids and capillary bed, the osmotic and hydrostatic
proteins that are labeled, and the measure- blood pressures are equal, resulting in
ment occurs in unlabeled media. The Rt relatively equal fluid flow between the
value is a fractional measurement, not an capillary vessel and the body tissue. And the
absolute quantity, and the passage explains osmotic and hydrostatic blood pressures are
that the measurement is made after transfer opposing forces, so the osmotic pressure
to the unlabeled media, and the passage itself is not bidirectional on the capillary
indicates that the Rt measurement is made in walls.
unlabeled media. 22. c. According to the passage, capillaries are nar-
19. b. SDS is an anionic detergent that linearizes rower than arteries. The continuity equation
proteins and imparts a negative charge to indicates that when a fluid is forced through
them, so the SDS-PAGE step is the first step a narrow section, it sees an effective velocity
that denatures the proteins of interest. As the increase. Therefore, directing blood to the
cells are still intact and producing protein capillaries should increase the flow rate
during this procedure, no protein denatur- because the capillaries are thinner than the
ation has yet occurred. Further protein dam- arteries. Dalton’s law describes gas partial
age occurs during Trypsin digestion, but pressures and is irrelevant to this and, while
denaturation already took place first during the principle in choice d is correct, the
SDS-PAGE, and the the SDS-PAGE step opposite effect will be observed.
already denatured the proteins of interest.

110
 –M C AT ® E X A M P R A C T I C E T E S T 1–

23. b. Blood has a low enough Mach number that 26. c. The change in length of an object under lin-
it is defined as incompressible in fluid ear thermal expansion is equal to (initial
dynamics. Alternatively, blood is non- length, m) × (linear expansion coefficient,
Newtonian, capillaries are neither long nor m/m°C) × (final temperature – initial tem-
straight, and the branching adds an addi- perature). Therefore the change in length of
tional layer of complexity, and blood flow is an object under linear thermal expansion is
not laminar due to mixing, as the capillary a function of initial length and the magni-
bed is full of branching vessels. tude of change in the temperature. The ini-
24. b. By definition, convective heat transfer occurs tial length is required, but it is not the only
due to bulk motion of fluids. Conductive value required, and is only required in con-
heat transfer is energy transfer via vibrations junction with the final temperature, which
at a molecular level through a solid or liquid, means that the magnitude of change in tem-
answer c is not a common term to describe perature is actually the value of which linear
heat transfer, and radiative heat transfer, by thermal expansion is a function.
definition, is the transfer of energy through 27. d. This choice is correct. Curcumin exhibits a
electromagnetic waves. strong UV-vis absorbance due to the π → π*
25. b. The area within the cardiac PV loop of each transitions within the conjugated pi bonding
ventricle represents the external work done system in the molecule. There are two car-
by that particular ventricle to eject blood, bonyl groups in curcumin, but they are not
which is a primary function of the ventricle. linked by an oxygen. Therefore, there is not
According to the graph, the area contained actually an anhydride group in the molecule.
within the PV loop for the left ventricle is Additionally, the hydroxyl groups alone are
much greater than the area contained within not responsible for the UV-vis signal, and
the PV loop for the right ventricle. There- spin-spin splitting is relevant in 1H NMR,
fore, when looking at the total amount of but it is unrelated to the observed UV-vis
work done by the ventricles, the left ventricle signal.
contraction has contributed more to that 28. b. This Lineweaver-Burk plot represents non-
total than the right ventricle. It is true that competitive inhibition. The passage states
the end-systolic pressure is higher than the that the Km stays the same, so the x-intercept
end-diastolic pressure, but the same cannot should be the same with and without cur-
be said about the volumes and, although the cumin, as the x-intercept is the negative
circulatory system is generally quite elastic, reciprocal of the Km. The Vmax decreases
the data presented here do not necessarily when curcumin is added; therefore, the
say anything of relevance pertaining to ven- y-intercept of the Lineweaver-Burk plot
tricle elasticity. should increase because it is the reciprocal of
the Vmax value. The plot in choice a repre-
sents uncompetitive inhibition, while the
plot in choice c is for competitive inhibition.
Finally, although Km does not change, the
Vmax does decrease.

111
 –M C AT ® E X A M P R A C T I C E T E S T 1–

29. c. Noncompetitive inhibitors change the Vmax n –n

32. d. Refracting power (cornea in air) = __________
cornea
R
air

but not the Km. Competitive inhibitors 1.38 – 1.00

= _________
0.0078 m
= 48 diopters
change the Km but not the Vmax, uncompeti-
tive inhibitors change both the Km and the Refracting power (cornea in water)
n –n 1.38 – 1.33
Vmax, and irreversible inhibitors bind = ___________
cornea
R
water
= _________
0.0078 m
= 6.4 diopters
irreversibly, usually via covalent bonds, to % of refracting power lost
the enzyme’s active site, essentially 48 diopters – 6.4 diopters
= _____________________
48 diopters × 100% = 87%
inactivating the enzyme. This is not what
Based on the calculation above, this is the
these data demonstrate.
percentage of refracting power that is lost
30. a. Most fluorescence emissions in proteins are
when the cornea is submerged in water.
due to excitation of tryptophan residues,
Choice a is the percentage of refracting
with a few emissions due to tyrosine and
power that remains when the cornea is sub-
phenylalanine. These particular amino acids
merged in water, choice b is the percentage
are aromatic and consequently exhibit fluo-
for the ratio of refractive indices of air to
rescence. Tryptophan is a relatively rare
water, and choice c is the opposite percent-
amino acid, and its fluorescence is very sen-
age for the ratio of refractive indices of air to
sitive. The quenching upon addition of cur-
water.
cumin is likely the result of conformational
33. d. The image equation can be used to solve for
changes and stacking interactions between
the effective focal length:
aromatic species. Alanine, cysteine, and glu- 1
__ 1 1 1 1
f
= __
d
+ __
d
________
= 1,000 mm
_______
+ 17.0 mm
= 0.0598
tamine residues are all not aromatic or 0 i

fluorescent. f = 16.7 mm
31. a. This equation correctly relates Gibbs free Based on the calculation above, this is the
energy with the dissociation constant Kd. correct effective focal length for the average
The equation in choice b would correctly eye for an object positioned 1 meter away.
calculate the kcat value in Michaelis-Menten The inverse of choice a is true, while choice
kinetics, choice c is a variation on the equa- b is one decimal place off from the inverse
tion for calculating the apparent Km value in value in choice a, and choice c is one deci-
the presence of the curcumin inhibitor, and mal place off from the correct answer in
in choice d the correct equation has the Kd choice d.
and ∆G swapped. 34. c. This is the correct angle of refraction, based
on the following calculation, which uses
Snell’s law:
n1sinθ1
θ2 = sin–1 ________
n2
= sin–1 1.00sin(80.0°)
___________
1.38
= 45.5˚
Choice a is the complementary angle to the
incident angle, choice b is the complemen-
tary angle to the correct answer, and choice
d is the angle of incidence.

112
 –M C AT ® E X A M P R A C T I C E T E S T 1–

35. b. If the eye is too long, the light rays are apt to 39. b. The general trend in ionic radii for cations,
focus before reaching the retina, causing particular for the alkali and alkaline earth
myopia. Other causes include altered curva- metals, is that ions become larger as you
ture of the lens and cornea. Insufficient move to the left and down on the periodic
refractive power would cause farsightedness, table. Moving down the periodic table
the refractive index would not fluctuate sig- increases the number of energy levels, while
nificantly to cause myopia, and, as myopia is moving left decreases effective nuclear
entirely the result of what is happening charge. Patterns are inconsistent within the
before any light rays hit the retina, defects in transition metals, but all transition metals in
the retina itself do not cause myopia. the top rows are smaller than the alkali and
36. c. The electric field of circularly polarized light alkaline earth metals in the same row, so the
moves around an axis in the direction of nickel and zinc ions are smaller than the cal-
propagation at a constant angular velocity. cium ion.
Choice a is true of linearly polarized light, 40. b. This is the structure of L-ornithine. The pas-
not circularly polarized light. Choice b is sage states that the arginase reaction involves
mostly true, except for the fact that angular the hydrolysis of arginine, with urea and
velocity remains constant with circularly L-ornithine as the products. The chemical
polarized light, as is choice d, except for the formula for urea is provided. Given the defi-
fact that angular velocity remains constant nition of a hydrolysis by nucleophilic water,
with circularly polarized light. the two reactants and one product, and the
37. b. The hydroxide from a base, like NaOH or UV-vis absorbance at 515 nm (indicating the
KaOH, attacks the carbonyl of the ester, presence of an amine group), the structure
forming a carboxylic acid. Triglycerides are of L-ornithine can therefore be elucidated.
esters by definition, and saponification only Choice a is the structure of L-canavanine.
occurs under basic conditions. This structure is very similar to arginine,
38. c. γ decay occurs when a nucleus in an excited except there is an extra oxygen inserted,
energy state emits a gamma ray, transition- choice c is the structure of L-lysine, and
ing it to a lower energy state but leaving the choice d is the structure of L-citrulline.
atomic number unchanged. a decay 41. d. The passage states that H. pylori prefers
decreases the atomic number by 2, b decay cobalt at pH 6. RocF from B. anthracis pre-
decreases (or increases, for b+ decay) the fers nickel at pH 9 (followed by Mn2+ and
atomic number by 1, and the atomic num- Co2+), based on the data in Figure 1. There-
ber decreases by 1 in electron capture. fore, B. anthracis RocF has a different metal
preference and a different optimal pH rela-
tive to the arginase from H. pylori.

113
 –M C AT ® E X A M P R A C T I C E T E S T 1–

42. c. The order of metal preference at pH 6.3 is 44. b. Figure 1 shows that nickel is highly pre-
Ni2+ > Mn2+ > Co2+, while at pH 9, the order ferred, but in vivo, its presence does not
of metal preference is Ni2+ > Co2+ > Mn2+. result in high arginase activity, which means
The data in Figure 1 only reflect the rate of that RocF in vivo only seems to have access
arginase reaction. No conclusions can be to manganese, even though it is not the pre-
drawn about metal binding affinities from ferred metal. Figure 2 shows measurements
these data, Figure 1 is not an assay that of arginase activity from harvested cells, not
directly measures viable cell growth, and the actual cell growth. The cells still grew even
levels of L-ornithine are measured after 24 though the cobalt and nickel trials showed
hours, so the overall production of product no significant arginase activity. The passage
is measured, not the rate of reaction. even states directly that cell growth occurred
43. a. The pKa for the side group of the aspartate by noting that cells were harvested and
residues is around 2.4, so both should be assayed for the viable cell arginase assay. Sig-
negatively charged at pH 6. Histidine has a nificant arginase activity is observed in vivo
pKa around 6, so it should not be charged in B. anthracis in the presence of manganese,
above pH 6. Both alanine and glycine will and Figures 1 and 2 do not measure reaction
not be charged. Therefore, most of the resi- rate, so the conclusion in choice d is not
dues should be uncharged at the provided supported by any of the data collected.
pH values. Histidine can be positively 45. b. If the CRR' carbon bonded with the carbon
charged, and it can interact with the metal of the protonated formaldehyde, a less stable
through its pi bonds. Histidine has pKa primary carbocation would form. The elec-
around 6, but it should not be charged above tronegativity difference actually goes the
pH 6. Of the five, only histidine is aromatic, other direction than indicated in choice a,
and only alanine and glycine are giving the CH2 carbon slightly more electron
hydrophobic. pull than the CRR' carbon since C has a
higher electronegativity than H, and Hückel’s
rule helps to determine if a planar ring mol-
ecule is aromatic. It is not relevant to this
reaction in any way. Finally, it is actually
more sterically favorable for the CRR' car-
bon to bond with the carbon on the proton-
ated formaldehyde, because it would keep
the larger R and R' groups farther away from
the rest of the molecule.

114
 –M C AT ® E X A M P R A C T I C E T E S T 1–

46. a. An elimination reaction removes two 51. b. The other two nitrogens are much less basic
substituents from a molecule to form a due to resonance effects and aromaticity.
double bond. A hydrolysis reaction involves The lone pair in choice a is in resonance
the breaking of a bond in a molecule using with the C=O carbonyl group, which makes
water, while a tautomerization reaction is the nitrogen significantly less basic, while
essentially a conversion to an isomer that the lone pair on the nitrogen in choice c is
often results in the formal migration of a a part of the aromatic ring system, per
hydrogen atom, and a nucleophilic Hückel’s rule. This effectively makes this
substitution reaction involves the selective nitrogen also much less basic. Because reso-
attack by an electron nucleophile to replace nance effects and aromaticity significantly
a leaving group. decrease the basicity of nitrogen 1 and nitro-
47. b. Because a dioxane and 1,3-diol form, the gen 3, nitrogen 2 is clearly the most basic of
reaction conditions must include a protic the three.
acid, a temperature lower than 70°C, and an 52. a. The carboxamide group is electron
excess of formaldehyde. (CH3)2CO is not a withdrawing, largely due to its carbonyl
protic acid, the temperature is over 70°C, group, which consequently makes the C-8
and the alkene is in excess. proton more labile. Choice b is actually the
48. d. Answer a does not correctly identify the reason why the C-5 proton is labile,
four-carbon chain as the longest chain of although the C-8 proton is significantly more
carbons upon which to base the name, labile than the C-5 proton, steric stress here
choice b does not match the structure at all, is not a reason to explain why the C-8
and in choice c the carbons in the four- proton is labile, and although LSD is largely
carbon chain have been numbered planar, the planarity does not contribute to
backwards. C1 should be the carbon at the the lability of the C-8 proton.
end of the chain with the hydroxyl group. 53. c. This is the IR spectrum for piperidine. There
is a weak band at 3,300 (2° amine stretching),
1,600 (2° amine bending), 3,000 (alkane
stretching), and 1,450 (alkane bending).
Choice a is not the IR spectrum for
acetamide because there are no bands
around 1,720 (C=O stretching). There is
also not a double band around 3,400−3,500
The carbons are numbered correctly, and all (1° amine). Choice b cannot be correct
side groups are identified correctly. because there are no sharp bands around
49. c. There are two carbons on each oxygen, and 2,240−2,260 for the cyanide group, and
there are also two lone pairs of electrons, choice d is not the IR spectrum for benzoic
each of which occupies a hybrid orbital, and acid. There are no bands around
choice d is not a relevant type of hybridiza- 1,705−1,720 (C=O stretching) or benzene
tion here. ring bands.
50. c. LSD has two chiral centers and therefore
22(4) unique stereoisomers.

115
 –M C AT ® E X A M P R A C T I C E T E S T 1–

54. c. In a gas reaction like this, decreasing the 55. b. The graph shows that lysine, like arginine, is
pressure will shift the reaction in the direc- positively charged in an amino group on the
tion that produces more moles of gas. end of a chain. The only feature that argi-
Therefore, decreasing the pressure will shift nine has that all of the other tested residue
the equilibrium to the left. Adding a catalyst 188 residues lack is the ability to form a
has no effect on equilibrium, adding O2 will bidentate H-bond, which is likely essential
shift the equilibrium to the right, and for substrate binding since the substrate
decreasing the temperature favors the exo- sucrose has several hydroxyl groups. The
thermic reaction, which shifts the equilib- polarity of residue 188 is important because
rium to the right. it exists in the transmembrane region, as
sucrose must be transported through the
hydrophobic interior of the lipid bilayer, but
both H and K are positively charged at pH
4.0 and did not result in a functional pro-
tein. The results obtained say nothing about
hydrophobic residues because none were
tested here, but because residue 188 is
located in the transmembrane region of
OsSUT1, residue 188 likely needs to be
hydrophilic for sucrose transport through
the hydrophobic interior of the lipid bilayer.
And every residue tested in place of R188
was smaller in size and still did not allow for
a functional protein.

116
 –M C AT ® E X A M P R A C T I C E T E S T 1–

56. d.
–
H2S + NO3 → S8 + NO
–
H2S → S8 NO3 → NO
–
8H2S → S8 NO3 → NO
–
NO3 → NO + 2H2O
–
8H2S → S8 + 16H+ NO3 → + 4H+ → NO + 2H2O
– – –
8H2S → S8 + 16H+ + 16e NO3 + 4H+ + 3e → NO + 2H2O
×3 × 16
– – –
24H2S → 3S8 + 48H+ + 48e 16NO3 + 64H+ + 48e → 16NO + 32H2O
___________________________________________________________
– – –
24H2S + 16NO3 + 64H+ + 48e → 3S8 + 48H+ + 48e + 16NO + 32H2O
–
24H2S + 16NO3 + 16H+ → 3S8 + 16NO + 32H2O
The balanced equation above shows that the coefficient for H2S is 24.

57. d. The data indicate that the reaction is zero- Part 3: Psychological, Social, and
order in [A] and second-order in [B]. That Biological Foundations of Behavior
means that the rate law is k[B]2, and the 1. d. Around eighth or ninth grade, students are
linear plot should be [B]–1 vs. t to determine transitioning to formal operational thought,
slope k. which includes both propositional logic and
58. c. The fractional distillation setup requires a combinatorial reasoning. This study is about
heat source and condenser. The liquid with individual cognition; Erikson’s work dealt
the lower boiling point evaporates first and with how individuals relate to the social
is condensed for collection, and so on, world. And according to Freud’s theory,
allowing for liquid separation. Fractional child development occurs in a series of
distillation separates liquids based on their stages focused on different pleasure areas of
boiling points and choice d actually the body. During each stage, the child
describes an organic extraction. encounters conflicts that play a major role in
59. a. The product is neutral overall, but internally the course of development. Finally, Maslow
it includes a positive and negative charge. focused on a hierarchy of needs. This study
Therefore, the product is one zwitterionic was not needs based.
compound.

H
–
CH3OH + BF3 CH3—O—BF3
+

117
 –M C AT ® E X A M P R A C T I C E T E S T 1–

2. a. Deductive logic is a logical process in which 5. d. During the transition to formal operational
a conclusion is based on the concordance of thought, children are also experiencing
multiple premises that are generally assumed puberty. Physiologically, the frontal lobe of
to be true. Children in the concrete opera- the brain begins more complex development
tional stage have problems with this concept. that can continue all the way until early
Perspective taking is defined as viewing the adulthood. The limbic system, which gov-
world from something other than one’s erns emotion, is not altered, the brain struc-
habitual vantage point. Children have trou- ture changes, but the structure is not located
ble with this in the preoperational stage of in the memory storage area, and the brain
development. Inductive logic involves going structures DO change as the individual
from a specific experience to a general prin- moves from one stage to another.
ciple. Children in the concrete operational 6. b. Maslow places physiological and safety needs
stage are fairly adept at this. And conserva- near the bottom of his hierarchy of learning.
tion refers to a logical thinking ability that is Children who go to school hungry or in fear
present in the preoperational stage of from violence in their neighborhoods will
development. not be able to concentrate as well as their
3. b. The majority of students moved from the more affluent peers who are well fed and rel-
concrete to operational levels. There was no atively safe. Although it is possible that there
difference between the two treatment is a correlation between living in poverty
groups, relaxation was not studied in this and violent crime, choice a is not based on a
study, and the difference between combina- child’s failure to meet lower-level needs as
torial reasoning and propositional logic was suggested by Maslow’s hierarchy. Choice c is
not tested in this study. based on Piagetian theory and choice d is
4. c. Descriptive statistics are used to describe the based on Vygotsky’s theory, not Maslow’s
basic features of the data in a study. They hierarchy of needs.
provide simple summaries about the sample 7. a. The sense of having always known someone
and the measures. Inferential statistics reach whom we just met is a sign of attachment,
conclusions that extend beyond the immedi- although it is sometimes absent in the
ate data alone. Inferential statistics try to romantic love sequence. This sense is a sign
infer from the sample data what the popula- of attachment, not attraction. Love can
tion might think. Estimates fall under infer- occur within the romantic love sequence,
ential statistics. Estimations are made about but it is not always a part of it, and lust is the
a population based on sample data. And sexual component of love and is not
modeling falls under inferential statistics described in this question.
and makes a set of assumptions concerning 8. d. Lateralization of cortical functions allows for
the generation of the observed data and sim- parallel processing. Both the right and left
ilar data from a larger population. brain are involved in parallel processing, and
conus medullaris is the tapered end of the
inferior end of the spinal cord.

118
 –M C AT ® E X A M P R A C T I C E T E S T 1–

9. d. Associative learning is related to spatial cog- 13. d. Social thinking is an intuitive process, so it is
nition and cognitive mapping. Reinforce- taken for granted. Social thinking is not
ment is a type of operant conditioning, related to IQ, people with high-functioning
avoidance learning is a type of operant con- social thinking do learn it from the environ-
ditioning, and spontaneous recovery occurs ment, but those with low-functioning social
with classical conditioning. thinking do not learn it naturally from the
10. b. Parents do use strategies to help their chil- environment, and many people with social
dren overcome social thinking difficulties. thinking disorders do NOT have a diagnosis.
Many people who have social thinking diffi- 14. a. Both parents and professional practitioners
culties do not have a diagnosis, research does have found her treatment programs useful.
in fact support the hypothesis that teaching 15. b. Synaptic vesicles are clustered beneath the
methodologies help children overcome membrane in the axon terminal located at
social thinking difficulties, and social learn- the presynaptic side of the synapse. They
ing begins during infancy. contain neurotransmitters, which are
11. c. Research has shown that interventions are released through the presynaptic terminal
effective on individuals who have scored and travel to a destination neuron, binding
near average to very high on intelligence to the postsynaptic axon terminal. The axon
measures. Social thinking is not a natural is a projection off of the neuron and is
process for a large number of people, many responsible for conducting electrical
people with social thinking difficulties have impulses away from the neuron’s cell body.
high IQs, and while there are few interven- Dendrites are the threadlike extensions of
tions available, they are effective with indi- the cytoplasm of a neuron. They are respon-
viduals who do NOT have a diagnosis. sible for sending action potentials to the cell
12. b. The dependent variable does relate directly body; they do not store neurotransmitters.
to the outcome of the study. While the And there is no cytoplasmic connection
control group is used in the study, it does between two neurons.
not relate directly to the outcome. The 16. c. Cocaine acts by blocking the removal of
experimental group is used to compare the dopamine from the synapse, which results in
outcome to the control group; it is part of the accumulation of an abnormal amplified
the design and is not used as the outcome signal to the dopamine receptors. Serotonin
variable. The independent variable sets up is typically related to major depression, not
the experimental and non-experimental cocaine use, while glutamate is related to
structure of the study; it does not relate schizophrenia and is not associated with
directly to the outcome of the experiment. cocaine use, and norepinephrine is not asso-
ciated with cocaine use.

119
 –M C AT ® E X A M P R A C T I C E T E S T 1–

17. a. Mental health workers have a high incidence 21. d. One of the factors contributing to the lack of
of vicarious emotional trauma. People who success in the program in THIS study was
treat patients with bipolar disorder and teachers’ desire to conform to their commu-
schizophrenia tend to have vicarious emo- nity. The teachers thought that one of the
tional trauma, not the patients themselves, reasons they did NOT work was lack of
and people who observe and interact with administrative support, but this is not a rea-
the individuals with alcoholism often have sonable conclusion from THIS study. The
vicarious emotional trauma. results of this study lend support to the con-
18. d. Mirror neurons are neurons that fire both clusion that bullying can be reduced, but the
when an animal acts and when the animal study in and of itself was not sufficient to
observes the same action performed by make this claim. And choice c is a future
another. The neuron “mirrors” the behavior hypothesis that is a logical follow-up to this
of the other, as though the observer were study but not a reasonable conclusion of
acting itself. This is important in self- THIS study.
regulation, which is implicated in autism 22. b. The treatment in the study caused the teach-
and schizophrenia. Mirror neuron dysfunc- ers to reexamine their own views, and this
tion is not typically found in patients with resulted in cognitive dissonance. Adaptation
bipolar disorder or major depression, PTSD would include the actual restructuring
or eating disorders, or obsessive-compulsive resulting from the cognitive dissonance
disorder or antisocial personality disorder. caused in the study. While cultural confor-
19. c. An imbalance in neurotransmitters may mity was an important variable influencing
contribute to anxiety disorders. The neu- the results, the teachers’ personal experiences
rotransmitters targeted in anxiety disorders in this study caused cognitive dissonance,
are gamma-aminobutyric acid (GABA), not conformity. And the independent vari-
serotonin, dopamine, and epinephrine. able was whether the teachers received the
Problems with axons do not cause mental intervention, not what resulted from the
disorders, while the neuron does relate to intervention.
neurotransmitters, the neuron itself is not 23. a. Gender is a socially constructed variable. Sex
the cause, and substance abuse can cause is a biological variable, age is a variable
problems with neurotransmitters. dependent on when the students are born,
20. a. The teachers who did NOT receive the inter- and the treatment length is a variable in the
vention are known as the control group. The experimental design—none are socially
teachers who DID receive the intervention constructed.
are known as the experimental group, the
dependent variable is the variable that
changes or does not change as a result of the
study, and the independent variable in this
study is whether or not the teachers received
the intervention.

120
 –M C AT ® E X A M P R A C T I C E T E S T 1–

24. a. The hidden curriculum shows up in this 27. d. Drive reduction theory says that humans are
study as educational institutions reinforce a motivated to reduce the state of tension
societal view that schools should prepare caused when certain biological needs are not
students for the real world, in this case dis- satisfied. Developed by Clark Hull in 1943, it
crimination and bullying due to gender was the first theory of motivation. Incentive
identification. Choice b identifies an aspect theory states that motivations are driven by
of experimental design, not the hidden cur- the desire for external rewards, but this was
riculum, choice c is consistent with the visi- not the first theory of motivation. Arousal
ble curriculum, that we teach students to be theory maintains our motivations are based
fair to everyone, regardless of gender identi- upon the notion of keeping an arousal at an
fication, and choice d is an example of equilibrium. This was not the first theory of
blame, not the hidden curriculum. motivation. An example of humanistic the-
25. b. Cultural assimilation occurs when new ory is Maslow’s hierarchy of needs, and this
members of a culture take actions to fit into was not the first theory of motivation.
the existing culture to facilitate their becom- 28. d. Stress that is considered good becomes dis-
ing part of the new culture. Accommodation tressing at the point of fatigue. Ill health
is the opposite of the correct answer, which effects occur after stress has become distress-
is assimilation. Accommodation occurs ing for a long period of time, good stress can
when the existing members of the culture occur after the comfort zone is achieved, and
change to fit the cultural mores of the new performance slightly increases even when
culture, thus changing the existing culture. stress becomes distressful.
Functionalism pertains to the different parts 29. b. An experimental design is one in which a
of a culture working together as a system. controlled experimental factor is subjected
This scenario refers to a much more specific to special treatment for purposes of compar-
situation. And stratification is what divides ison, with a factor kept constant. A case
cultures into individual, usually ranked, study is an in-depth study of a particular
classes. In this case, had one of the two cul- research problem, usually with a single indi-
tures been relegated to a position above or vidual or topic. Cross-sectional research
below the other, it would have been designs have three distinctive features: no
stratification. time dimension, a reliance on existing differ-
26. a. Animals adapt to their environment but do ences rather than change following interven-
not use adaptation as a signal to communi- tion, and groups that are selected based on
cate with other animals. Apes, dogs, and existing differences. The cross-sectional
ravens, in particular, use gaze following as a design can only measure differences between
form of communication and signaling. Fish, or from among a variety of people or sub-
for example, can give off a faint electromag- jects. And descriptive research designs pro-
netic field that plays a part in predator-prey vide answers to the questions of who, what,
relationships. And olfaction is one of the when, where, and how associated with a par-
oldest methods of communication but is ticular research problem.
difficult to study because of intervening
variables.

121
 –M C AT ® E X A M P R A C T I C E T E S T 1–

30. b. The graph is a common example of research 35. a. Music is a classic example of symbolic inter-
that came out of the James-Lange theory. actionism. It is central to many teens’ lives,
Cannon-Bard worked to refute the James- and the type of music they listen to can
Lange theory, Piaget and Maslow did not do influence their identity formation. Through
work in this area, and Schachter-Singer the- music, they attach meanings to their rela-
ory came much later than James-Lange. tionships with the world and themselves.
31. d. Filling out and signing the IRB form is strict The majority of teens do not emulate their
protocol for studies with human subjects. favorite movie and television stars, and even
The IRB form is intended to protect the sub- those who do tend to maintain the same
jects and must be turned in; if it is turned in gender identity. Additionally, mass media
2 weeks late, damage could already have tends to negatively affect teens’ self-efficacy
occurred to the subject; and as it is meant to (having to be thin, popular, etc.), and class
protect the participants, the form must be identity is not likely to be affected by mass
turned in before the start of the study. media.
32. c. This is an example of James-Lange theory, 36. d. A positive family life is most likely to prevent
which is still accepted today. Choice a is an teen depression. Although church may help
example of Schachter-Singer theory, choice teens avoids depression, it is not the support
b is an example of Cannon-Bard theory, and system that is most likely to prevent it.
choice d is the reverse of James-Lange Although exercise is positive, physical educa-
theory. tion class can be the location of bullying and
33. a. Peer pressure and the activities that go with body image problems, and, relatedly, school
it, like bullying and gossip, can cause depres- is the source of many of the stressors affect-
sion in teens. Exercise can help with the ing teens and is more likely to cause depres-
symptoms of depression, while cutting and sion than to help prevent it.
promiscuity are associated with depression, 37. c. Mass media can make teens feel negative
not causes of it, and cutting back on social about their appearance and thus can signifi-
activity is a sign that a teen is already cantly lower their self-efficacy. Family life
depressed. can be a major stressor in teens’ lives, but
34. b. School is a place where a lot of stressors take other stressors affect self-efficacy more,
place, and it is where teens spend a large while teens’ favorite music tends to make
amount of time. Although mass media can them happier and have higher self-efficacy
be a stressor, the school setting is more likely in most cases, and the workplace can be a
to lead to teen depression. Church is a gen- positive part of a teen’s life and is much less
erally positive agent of socialization, and likely than the other choices to lower
most teens do not work. Those that do self-efficacy.
would spend much less time there than at
school.

122
 –M C AT ® E X A M P R A C T I C E T E S T 1–

38. a. The child has the concrete knowledge that A 42. d. Impression management is a conscious or
(lightning) causes B (thunder) but does not subconscious process in which people
understand the abstract reasoning of how A attempt to influence other people’s percep-
causes B. While the child understands that A tions of a person, object, or event; they do so
causes B, in order to be formal operational, by regulating and controlling information in
he or she must be able to understand the social interaction. They could be trying to
abstract concept of how lightning’s static influence perceptions about themselves or
electricity interacts with air to cause thun- others. Although gender plays a role in the
der. Similarly, the preoperational child interviewing process, it is not what she is
would be able to identify lightning and practicing in this scenario; speech is part of
thunder separately but would not be able to the scenario; and although choice c includes
understand the concept of causation a social interaction, it is not the main theory
between the two, and the sensory-motor operating here.
child would see lightning and perhaps react, 43. b. Gentrification is the process of renewal and
and would hear thunder and perhaps react, rebuilding accompanying the influx of
but would have no concrete knowledge of middle-class or affluent people into
either of the two entities. deteriorating areas that often displaces
39. c. Ethnocentrism is the evaluation of other poorer residents. Urban blight is the process
cultures according to preconceptions origi- whereby a previously functioning city, or
nating in the standards and customs of one’s part of a city, falls into disrepair, often due to
own culture. Cultural relativism is the prin- environmental factors. Meritocracy is the
ciple of regarding the beliefs, values, and process in which people’s progress is based
practices of a culture from the viewpoint of on ability and talent rather than on class
that culture itself. Therefore, both can be privilege or wealth and intergenerational
found in individuals and specific nations. mobility refers to changes in social status
40. d. Group polarization refers to the tendency between different generations within the
for groups to make decisions that are more same family. And even though gentrification
extreme than the initial inclination of its may integrate neighborhoods, the original
members. Deindividuation is losing self- residents continue to be marginalized, so
awareness in a group, deviance is departure social stratification remains in place.
from usual or accepted standards, and 44. a. Good healthcare tends to be lacking in these
groupthink is when the desire for harmony neighborhoods before gentrification occurs.
or conformity in the group results in an irra- Housing values are likely to increase with
tional or dysfunctional decision-making gentrification, the question describes local
outcome. inequalities, not global, and people moving
41. a. Persuasion is a major component of the into the neighborhoods would likely bring
elaboration likelihood model, but not a an increase in wealth, so poverty is not
major component of social cognitive theory, something they would experience.
enculturation theory, or the observational
learning model.

123
 –M C AT ® E X A M P R A C T I C E T E S T 1–

45. c. When a neighborhood becomes more popu- 48. a. A correlation is a statistical measure that
lar, residents will need easier ways to travel indicates the extent to which two or more
to and from their home neighborhood to variables fluctuate together. A correlational
work and other parts of the city. Accessibility relationship does not mean it is causal.
of a neighborhood makes it a more desirable There would need to be evidence that high
place to live. While residents may push for health beliefs cause high self-concepts.
more parks, it is not something that will Scores on one measurement cannot predict
“have to be improved” in the gentrified scores on the other, and if there were vari-
neighborhood. The type and variety of res- ability when examining the measures, a posi-
taurants in a neighborhood often changes tive relationship would not have been found.
because of gentrification, but it is not a 49. c. Locus of control in psychology refers to the
requirement to create a gentrified neighbor- extent to which individuals believe they can
hood, and the pace of change in the neigh- control events affecting them. It is based on
borhood happens on its own and does not two conditions. A person with an internal
need to be improved. locus of control believes that she has control
46. d. Students from the existing neighborhood over her life—that life is not based on
may be displaced due to socioeconomic rea- chance. A person with an external locus of
sons—their parents might not be able to control believes she is powerless and that
afford to live in the newly gentrified neigh- events that occur and happen to her are
borhood. All children will experience hidden based on factors from the environment or
curriculum within the education system, in- due completely to chance. Choice a is the
group bias refers to a pattern of favoring definition of the construct health beliefs as
members of one’s in-group over out-group used in the study, choice b a definition of
members—both groups of students are self-concept, and choice d the definition of
likely to experience bias—and a meritocracy self-esteem.
is a social system in which people’s success in 50. d. The dependent variable is the outcome of
life depends primarily on their talents, abili- the experiment that determines whether the
ties, and effort, so both groups of students hypothesis was supported. The control
will experience this through the grading group is the group that does not receive the
structures used in the education system. treatment, the treatment group is the group
47. b. Poor families are unlikely to be able to afford that does receive the treatment, and the
to live in areas with rising property values training the experimental group received is
and increasing rents. Assimilation is less the independent variable.
likely to occur. Existing families are likely to
move out, and the new families will deter-
mine the new culture of the neighborhood.
Additionally, violence in families will not
necessarily change due to gentrification, and
culture lag has to do with changes due to
technology, not gentrification.

124
 –M C AT ® E X A M P R A C T I C E T E S T 1–

51. b. Obedience is compliance with an order, 53. a. The doctor’s neural activity is an example of
request, or law or submission to another’s internal noise. In signal detection theory,
authority. The key aspect of obedience is internal noise refers to the fact that neural
that just because you have changed in some response will be different even if the external
way does not mean that you agree with the stimulus presented is the same every time. In
change. The nurse followed orders because the example above, the CT of the lung is the
they came from a perceived authority figure. same in each instance, but the neural activity
Peer pressure is influence from members of of the doctor will be different with each
one’s peer group. A doctor would be in a viewing. External noise is external to the
position of authority, not a peer; the doctor and may be, for example, a smudge
bystander effect occurs when individuals do on the film; internal response is the decision
not offer any means of help to a victim when the doctor makes in her brain after the inter-
other people are also present; and social nal and external noise have been taken into
loafing is the phenomenon of people exert- account; and uncertainty pertains to the
ing less effort to achieve a goal when they overall theory of signal detection, not a spe-
work in a group than when they work alone. cific part of it.
52. b. The passage explains signal detection theory, 54. a. Psychophysics is the branch of psychology
a means to quantify the ability to discern that deals with the relationships between
between information-bearing patterns and physical stimuli and mental phenomena.
random patterns that distract from the Gestalt psychology has to do with the sum
information. The random patterns are called being greater than the parts, neuroscience
noise and involve random activity of the studies the structure or function of the ner-
detection machine and of the nervous sys- vous system and brain, and cognitive psy-
tem of the operator. Sensory adaptation is a chology is the study of how we think,
change over time in the responsiveness of remember, decide, and perceive.
the sensory system to a constant stimulus, 55. c. In an experimental design, the control group
the somatosensory system relates to a sensa- and experimental group are the same, except
tion (such as pressure, pain, or warmth) that the experimental group is the one in which
can occur anywhere in the body, and Weber’s some type of manipulation has been enacted
law quantifies the perception of change in a that was not done to the control group.
given stimulus. It states that the change in a Since there are two groups and the attending
stimulus that will be just noticeable is a con- physicians are the control group, the first-
stant ratio of the original stimulus. year residents are the experimental group.
The dependent variable is the outcome of
the decisions the doctors make about the
images, the independent variable is the set of
images used in the study, and there is no
treatment group in this study.

125
 –M C AT ® E X A M P R A C T I C E T E S T 1–

56. d. Neuroscience studies the function of the 59. c. Labeling theory is how self-identification
brain, which is clearly depicted in this quote. and behavior of individuals may be deter-
Choice a deals more with cognitive science mined or influenced by the terms, or
than neuroscience, uncertainty is inherent in “labels,” used to describe them. Self-fulfilling
signal detection theory, not neuroscience, as prophecy, as described in the question,
presented in this passage, and choice c is an would fall under this theory. Differential
example of external noise. association theory is the theory that through
57. c. When a condition that the learner does not interaction with others, individuals learn the
like is removed to reinforce a desired behav- values, attitudes, techniques, and motives for
ior, it is negative reinforcement. In this case, criminal behavior. Strain theory states that
solitary confinement is removed to reinforce social structures within society may pressure
the good behavior exhibited by the prisoner. citizens to commit crimes. And behaviorism
Extinction removes a behavior entirely takes the view that learning occurs through
through classical conditioning. There is no rote memorization and is not a key compo-
indication the behavior will not return; nor nent of criminology.
is classical conditioning used. Classical con-
ditioning is an example of negative rein- Part 4: Critical Analysis and
forcement, which is a type of operant Reasoning Skills
conditioning, not classical conditioning, and 1. c. Goldman argues throughout the passage
positive reinforcement would be if the pris- that when art deals with pressing social
oner was given something he or she wanted, issues, it can inspire change more effectively
such as a particular book to read, to rein- than political speech. In the last paragraph,
force positive behavior. she discusses how American drama fails to
58. b. All of the symptoms in the question are inspire social significance. Goldman might
signs of elder abuse. People with MS will argue that European drama is therefore
typically show bruises if they’re walking and superior, but the larger point of the passage
their coordination is affected, but social is that American drama has not yet realized
withdrawal and arguments with the care- its potential for social change. Goldman
giver are not typical symptoms of the might agree with the statement in choice b,
disease. but rather than saying political speakers
need to get their message out through cre-
ative work, the main point of her passage is
the opposite—that creative work has the
power to inspire political/social change.
Finally, Goldman mentions art for art’s sake
in the opening of the passage but moves on
from there to discuss art as a “mirror to life.”

126
 –M C AT ® E X A M P R A C T I C E T E S T 1–

2. a. Historically, political speakers would give 4. b. In the context of the passage, Goldman dis-
impromptu speeches on social issues on the cusses the effectiveness of the language of art
street, often standing on a shipping crate as and its ability to embrace the “entire gamut
their “stage.” The term has come to take on a of human emotions,” which is more moving
metaphorical meaning. The phrase has no than the examples of “stereotyped phrases”
implication regarding the height of the ora- used by the “average radical.” Goldman
tor, and while soapbox orators may be elo- advocates the use of art as a means of advo-
quent, the term addresses the political or cating social ideals, but she provides these
social nature of their speech rather than the examples of language as overused, ineffective
purity of their language—nor does it have political speech, and while she uses the term
anything to do with actual soap or “symbols of revolt,” these are not Strind-
cleanliness. berg’s symbols; rather, they are examples of
3. c. Goldman mentions that American drama the speech of radicals and conservatives.
has been used for amusement only and that Finally, Goldman compares radicals to the
Americans have not had access to European “man devoid of all ideas”: they are both
drama in print. The implication is that strapped to their limited terminology. The
European drama contains social ideas or phrases provided aren’t actually devoid of all
political messages that the average American ideas, but Goldman suggests they are as trite
theatergoer has yet to experience. While the as if they were.
statement in choice a is true and something 5. a. Whistler is advocating the notion of “art for
the reader can infer, it is not something art’s sake.” Goldman says this type of art
Goldman could imply, since she would have “presupposes an attitude of aloofness on the
had no knowledge of the Internet. part of the artist” and distinguishes modern
Additionally, Goldman discusses the art as one that speaks in a “language embrac-
availability of theater in America and does ing the entire gamut of human emotions.”
not consider a theatergoer’s ability to travel; Goldman dismisses this notion of art. Else-
therefore, choice b does not imply that it where, Goldman does not really discuss art-
would never happen—and Goldman says ist intention and therefore would not likely
that plays have not been available in print, so advocate its irrelevance and, while the pas-
whether or not the average American would sage focuses on dramatic art, Goldman
like to read a European play is irrelevant. makes statements about art in general, even
saying “those who wield the pen or brush” to
indicate that social implications of art apply
to both drama and painting. Additionally,
the statement in choice d is not really a
response to Whistler’s claim about art, and
although Goldman’s comments feature a
discussion of radical and conservative politi-
cians, she does not criticize their ideals as
“clap-trap” but rather criticizes the
effectiveness of their methods for expressing
their ideas.

127
 –M C AT ® E X A M P R A C T I C E T E S T 1–

6. d. Goldman mentions “those who wield the 8. b. Anderson praises Stein’s work in a defensive
brush or pen” (i.e., the writer or painter) as mode, suggesting that the “loud guffaws” are
being overlooked by politicians, when in fact those of Stein’s critics, indicating also his
powerful social messages may be communi- wish that at least writers would attempt to
cated through art. Goldman specifically understand her work. He clearly praises
mentions Walt Whitman as one of the writ- Stein and says the loud guffaws “do not irri-
ers whose work mirrors the social revolt of tate me”—if the guffaws indicated delight,
his time, but the bumper sticker takes a tiny he would not mention irritation—and
phrase of his larger work and reduces it to a implies that the guffaws at her work are
slogan. While it contains his words, the more mocking than genuine laughter.
bumper sticker is not really an example of Finally, while the statement in choice d may
Whitman’s art. An advertisement, whether be true, the public laughter probably would
containing dramatic actors or not, is closer not reflect an implication that the work was
to the propagandist’s speech mentioned by written for nonwriters.
Goldman than the “creative genius, imbued 9. b. Anderson discusses Stein’s innovative use of
with the spirit of sincerity and truth.” words, emphasizing her use of small, every-
Finally, Goldman quotes Strindberg, who day words that are often neglected by writ-
equates the dramatist with a “lay preacher,” ers. The discussion of the frustration with
but dismisses the religious nature of Strind- language’s limitations emphasizes Stein’s
berg’s metaphor. Martin Luther King Jr. was ability to make the small words better, rather
a preacher whose orations moved many for than her need to search for better words. He
social change, but he was not known as an is not talking about the difficulties of writing
artist. Goldman focuses on the power of art in the context of Stein’s relationship with
for social change. her critics; that comes later. Nor is he
7. b. Anderson’s overall point is that Stein is self-reflexively discussing the passage essay
doing something important with words, ele- itself, and the difficulty of writing it. While
vating plain words, “recasting” everyday Anderson does mention the desire to create
words into poetry. The “money saving images in the mind of the reader, he does
words” that follow this quote may mislead a not entertain the possibility of a multimedia
reader to agree with choice a, but the lan- or image-based literature.
guage is metaphorical—so it does not mean
she was literally a housekeeper or had to
scrimp and save but instead says something
of the language she used in her poetry.
Anderson is using metaphorical language to
describe Stein’s poetry, which uses words
that would not traditionally be considered
poetic. Further, Anderson does not indicate
that Stein has a social message in her poetry
but considers the words she uses as
“neglected citizens”; Stein is not literally
speaking about neglected citizens.

128
 –M C AT ® E X A M P R A C T I C E T E S T 1–

10. a. Anderson contrasts Stein’s work with epic 12. b. Anderson is very much focused on Stein’s
poetry and novels with grand ideas and language. The entirety of paragraph 3 is a
describes Stein’s work in terms of using little, description of how he values the ability of
underappreciated words. Here is a list of words to create a sensory experience. Ander-
common everyday things. In paragraph 5, son does not write a great deal about Stein’s
Anderson mentions “sonnets to my lady’s life, except to say that she did not write nov-
eyes” in contrast to Stein’s work, and while els or plays, and he does not incorporate her
the line in choice c seems to discuss biography into an understanding of her
neglected citizens, Anderson uses the term poetry. He also does not really consider
“neglected citizens” as a metaphor to Stein’s meaning but is rather focused on her
describe the types of words Stein uses—not language; he does not focus on the reader as
her subject matter. Finally, “exultation” and meaning maker but instead focuses on the
“eternity” sound like grand ideas, which is in writer’s perspective. Additionally, Anderson
contrast to how Anderson describes Stein’s does not examine the structure of Stein’s
work. work, as he does not even provide an exam-
11. a. Anderson admires the way Stein uses the ple of a single line.
neglected everyday words in poetry (perhaps 13. d. Darwin focuses his discussion on processes
ones that would be found in a grocery list); like production and extinction and the
many other critics at the time did not. interplay between diverse life forms in
Anderson does not mention rhyme or for- nature to posit how life changes over time
mal structure, or the Romantics, nor does through a process of natural selection. In the
his explanation seem to indicate that Stein first sentence, Darwin states that many
does not use elegant words, but instead ele- authors hold this view expressed in choice a,
vates common, ordinary words. But choice c but the subject of these authors or their
focuses on the mixing of the elegant and the arguments is never revisited. He mentions
vulgar. If Anderson were responding to this gravity only once and does not go into detail
critic, he might have agreed with him or her about its effects on how various species
and then explained how this mix is developed over time, and while Darwin
innovative. refers to beauty and perfection, his main
goal is not to describe this aspect of life.

129
 –M C AT ® E X A M P R A C T I C E T E S T 1–

14. d. With these word choices, Darwin seeks to 16. d. Darwin describes a similar process in the
emphasize the elegance of the process of passage through small variances over a long
natural selection. Darwin mentions “the period of time but does not have the termi-
Creator” elsewhere in the text, but the over- nology from contemporary genetic science.
all passage argues a scientific phenomenon The process of natural selection as described
rather than divine creation, and in describ- by Darwin happens through a “war of
ing a process that involves a “war of nature,” nature,” not through scientific experimenta-
Darwin emphasizes through his word choice tion, and Darwin at no point describes radi-
the elegance of this process rather than the cal changes from species to their offspring,
savagery. Finally, while Darwin’s descriptions but rather a long slow process of transfor-
seek to elevate species and the complex pro- mation through natural selection. Finally,
cess they undergo, he does not go so far as to Darwin says that futurity will contain “larger
advocate that all species are in their “most and dominant groups, which will ultimately
perfect state.” prevail and procreate new and dominant
15. b. Darwin makes a direct connection between species,” but he does not mean that the earth
“famine and death” (both things that sound will only be populated by large animals in
bad) and the “most exalted object” (some- the future.
thing that sounds good), implying irony. The 17. b. This answer describes a process similar to
fact that good things can stem from bad natural selection as described in the passage,
highlights his awe for the process of natural except it is applied to ideas rather than spe-
selection. In context, Darwin is using exag- cies. The passage posits that species are not
gerated language to highlight how awe independently created but evolve over time.
inspiring the process of natural selection is, If ideas function as species do, then ideas do
not to make a philosophical claim about the not originate independently in the brain but
limitations of human cognition or the exis- are influenced by external pressures as well
tence of higher powers beyond humankind. as ideas of the past. Darwin discusses species
The “higher animals” he describes may likely of the far-distant future, but the logic of his
be predators, but this is a logical inference argument does not apply to ideas. Finally,
made by the reader rather than something that all species are descended from one or a
Darwin implies. When he discusses the few original species is discussed by the
“most exalted thing,” he does not mean to author in the passage, but this is not a
exalt predators but rather describe more description of the process of natural selec-
complex life forms. Finally, while someone tion; rather, it is the condition posited by the
could use Darwin’s statement to make the author that precedes natural selection.
argument laid out in choice d (or potentially
to argue the opposite), it is not implied by
the author. Darwin does not discuss the mil-
itarized proclivities of human society.

130
 –M C AT ® E X A M P R A C T I C E T E S T 1–

18. c. Darwin states specifically, “of the species 20. b. Thoreau makes a connection between paths
now living very few will transmit progeny of of the earth and the paths of the mind as
any kind to a far distant futurity.” Endan- being “impressible.” In context, he likens
gered species today would not likely be highways to the “ruts of tradition and con-
among the “very few” that the author dis- formity,” suggesting further that people tend
cusses, and while he discusses how all species to follow the same paths and may conform
undergo a “struggle for life,” which would to the same ideas. The first part of the
include endangered species, he does not take answer may sound correct, but the statement
a stance on the morality of the process. has nothing to do with evolution, while
Darwin emphasizes a beauty to the choice c treats the earth metaphor too liter-
“production of higher animals” but does ally and conflates pathways in the brain with
not emphasize the beauty of extinct species. “the paths, which the mind travels.” Thoreau
Logically it would follow that he would not does not consider neural pathways or refer
emphasize the beauty of species in danger of to different societies. Finally, Thoreau’s main
becoming extinct. And while he could agree intention is not to insult those who follow
that humans endanger other species, but it is tradition.
not clear that he would claim that the 21. c. Thoreau uses this quote to demonstrate
human species is beyond the natural world. Mirabeau’s attitude toward laws and follow-
19. d. Thoreau critiques convention and habit and ing authority but argues that one should not
emphasizes that one should be “obedient to simply oppose laws and authority but be
the laws of his being” and advance “confi- governed by the “laws of his being.” Thoreau
dently in the direction of his dreams.” He does not discuss the use of militaries or
merely begins his discussion with Mirabeau Mirabeau’s use of metaphor. And while
and then moves on to discuss other subjects, choice d is Mirabeau’s argument and a cor-
mentions leaving the woods as part of a rect explication of his quote, Thoreau does
larger explanation of his personal philoso- not employ the quote simply to agree with
phy, and uses the “cabin passage” as a meta- what Mirabeau has said.
phor and at no point discusses a real sea 22. a. A civil rights activist is likely governed by “a
voyage. Finally, Thoreau implies that a just more sacred law” if she opposes an unjust
government is a rarity; however, the author’s law like segregation. The hungry man finds
main focus is not on government laws. himself in opposition to the law not because
he believes it is unjust or believes in a greater,
more sacred law, but out of desperation and
hunger, while the driver has a reckless
disregard for the law rather than a belief that
it is unjust and the banker highlights ways to
work around the law but has nothing to with
a greater sense of self or purpose.

131
 –M C AT ® E X A M P R A C T I C E T E S T 1–

23. a. This choice most closely resembles the atti- cottage) when it does not suit the grandeur
tudes expressed in paragraph 2, where the of its surrounding environment. This means
author expresses his desire to “go before the not that neatness in itself is a bad quality but
mast and on the deck of the world, for there that it requires a more appropriate setting.
I could best see the moonlight amid the And while he does discuss the offensiveness
mountains.” In paragraph 1, Thoreau men- of the small cottage as it disrupts the natural
tions that Mirabeau disobeys authority sim- scene, he offers other examples of architec-
ply to test his resolve and demonstrates his ture that would enhance the scene, so it is
disagreement with this attitude, and when not simply that any building on the hillside
Thoreau discusses a sea voyage as a meta- would be offensive. Finally, the purpose of
phor (“the deck of the world”), he says, Ruskin’s description of the natural scene is
“I do not wish to go below now.” To stay not to say that it is better than any piece of
belowdecks and keep to himself does not architecture—in fact he also admires several
align with the attitude that he has “several other architectural examples—but rather to
more lives to live.” Thoreau discusses confor- criticize the small piece of architecture that
mity in paragraph 2 and has the attitude that exists in this natural scene in order to exam-
a man should forge his own path, be obedi- ine the relationship between structure and
ent to the laws of his own being, and follow setting.
confidently in the direction of his dreams. 26. c. The metaphor emphasizes the smallness of
Nonconformity is not simply for the sake of the cottage, which, like a fallen toy, is not
being unconventional but to make space for where it should be. Ruskin does not mention
a greater sense of the self. that the cottage is in need of repair, and
24. c. Thoreau emphasizes that an individual must elsewhere he even mentions the cottage’s
be obedient to the laws of his being over any “neatness” and “ornamentation,” although
laws created by society. While he might agree these features contribute to its unsightliness,
that individuals are shaped by their experi- and while choice b might seem like a logical
ences, he does not discuss the origin of the choice because the cottage is being equated
individual, so it is unclear whether he would with a child’s toy, perhaps equating the creator
agree that the individual begins as a blank of the cottage to a child, the focus of the meta-
slate, and he does not discuss a scientific phor is the cottage rather than its creator. The
notion of the self. Additionally, Thoreau entire passage discusses the aesthetics of the
places great stock in individuality and does cottage in its setting without really mention-
not attempt to dismantle the self into ing the architect who put it there. Finally,
thought processes. Ruskin criticizes the cottage harshly through-
25. b. Ruskin provides several examples of “mag- out the passage. His level of attention could
nificence” in architecture (the Parthenon, possibly be described as “fascinated,” but the
the Pyramid of Cheops, and St. Peter’s) that author by no means finds the cottage “won-
would fit in well with the “colossal” Alps, drous,” nor does he imply that all viewers
while criticizing the small cottage that is out would see it the same way.
of sync with the scene. Ruskin criticizes the
neatness of a specific piece of architecture (a

132
 –M C AT ® E X A M P R A C T I C E T E S T 1–

27. a. Ruskin mentions these famous structures as around it and vice versa. Choice a may be
examples of architecture that could match good advice, especially given Ruskin’s harsh
the beauty and magnitude of the setting of critique, but it does not speak to his
the Alps, saying that the visual effect of each intention or the real purpose of the passage,
would be enhanced by their juxtaposition. and while Ruskin’s metaphor for the cottage
While Ruskin imagines these buildings in is as “a child’s toy let fall on the hillside,” uses
the setting of the Alps, their actual location this metaphor primarily to portray the visual
is not discussed. And the mention of older, proportion of the cottage in the Alps rather
even ancient, structures is not to emphasize than to suggest some architect treated his
age, but to introduce famous references that project recklessly. Finally, choice c is a very
the reader might know. The cottage is not literal reading of the passage, instead of
discussed as an emblem of all modern archi- grasping a broader interpretation that can be
tecture but used to discuss the way architec- applied to another situation. While Ruskin
ture and environment interact. Finally, primarily discusses a cottage in the Alps in
Ruskin does not mention the building mate- the passage, he discusses specifics of color,
rials of these famous structures; he rather material, and size of the cottage as incongru-
focuses on their proportions. ous to the landscape. A cottage made to fit in
28. b. A skyscraper would look rather bizarre in a with the landscape on a smaller hill could
country lane; the setting would not enhance work better.
the beauty of the building nor vice versa, 30. b. The quote sounds very similar to Ruskin’s
which is precisely what Ruskin rails against main point in the passage—that a piece of
in the passage. The passage is all about the architecture should fit in with its setting and
interplay between a building and its sur- enhance it. The excerpt from Ruskin’s work
rounding. Times Square is full of neon signs critiques the cottage as a piece of architec-
and advertisements, and a McDonald’s ture but is too dismissive to consider the cot-
would fit in appropriately with the city tage an “artistic creation” and certainly does
scene. The author mentions the Pyramid of not consider the philosophy behind its cre-
Cheops in the passage as one example of a ation the way Wright does. In the discussion
building of magnitude that could match the of materials, Ruskin critiques the “neatness”
grandeur of the Alps; the scale of the and “weakness” of the deal boards (made of
Pyramid is enhanced by the vastness of the pine or fir) of the cottage, but it’s unclear
desert. Finally, Ruskin discusses examples of whether he finds the materials unappealing
larger structures in the Alps that would look by themselves or only in contrast to the
better than a tiny cottage, and a castle, which beauty of the natural materials around the
is considerably larger than a cottage, would cottage. He would certainly say the wood
probably not offend his sensibilities. was not well used by the architect of the
29. d. This is the larger point of the passage—that cottage, but choice c is too tenuous
the small cottage is offensive to the eye compared to choice b. Ruskin does not
because it is incongruous with the landscape believe that building the cottage has glorified
around it. If Ruskin were to give advice, it the wood at all but rather made it look
would be that architects should strive to “dead, raw, and lifeless.”
create work that enhances the landscape

133
 –M C AT ® E X A M P R A C T I C E T E S T 1–

31. d. All of these statements are examples from sentence, Tridon refers to “autistic ways” as a
the third paragraph, where Tridon lists rigid frame that psychologists stretch their
various aspects of Freud’s theories of dream theories on. The metaphors are not
psychology. In this passage, Tridon discusses particularly connected, and this answer
Freud’s theory of wish fulfillment (I), but he choice does not help pinpoint the author’s
also discusses Freud’s connection between meaning. Tridon does not focus on
dreams and insanity (II), as well as the idea psychologists’ arrogance but rather the
that dream visions are symbolic (III), and distortion of their ideas. The reference to the
the the third choice is a statement that aligns birth of Minerva refers to the psychologists’
with Freud’s theories, but it is not the only hypotheses rather than the psychologists
one, and it is not only (I) and (II) that are themselves. And Tridon does not appear to
correct. believe that ideas that come from the brain
32. c. Tridon says specifically that these psycholo- become weakened under further
gists’ methods were not supported by evi- consideration.
dence. Tridon does not discuss the emotions 34. d. In trying to discuss Freud’s use of empirical
of these psychologists in his criticism, and evidence, Tridon uses this colloquial phrase,
the issues with these methods as discussed which does not sound like a precise fact, so it
by Tridon have nothing to do with how the does not sound like appropriate evidence for
theories are communicated but relate to the his argument. In the first paragraph, Tridon
nature of the theories themselves. Finally, tries to explain Freud’s use of empirical evi-
while answer d sounds like something Tridon dence for his theories by pointing out the
could say, elsewhere he uses the words time and consideration he employed to
“empty” and “artificial” to criticize this develop them, not with an emotional appeal.
method of psychological theorizing. But in The use of quotations may be suspect
context, Tridon describes these methods as because Tridon does not attribute the quote
inventions, focusing particularly on the fact correctly or clarify whether he is in fact
that they are not supported by evidence. quoting Freud. But in describing Freud’s
33. b. Minerva represents the birth of a hypothesis, methods, Freud’s own statements would
and the “stretched hide” indicates that reality actually be useful. This piece of criticism
had to be killed to wrap it around the used in choice c is vague rather than incisive.
theoretical framework. Before Freud Tridon’s phrasing is odd, but he is saying
developed “the truth is what works,” that Freud looked at the facts, rather than
according to Tridon, many psychologists suggesting “ideas just came to him.”
had theories that negated reality instead 35. a. In the first paragraph, Tridon mentions that
of reflecting it. Tridon is using a string of Freud did not have preconceived notions of
metaphors at this point in the text, which his dream theory but instead observed evi-
makes his meaning complex and confusing. dence of patterns in his patients. This could
Choice a attempts to take two separate be a response to accusations that Freud went
metaphors and mash them into one. looking for a specific pattern that matched
Minerva was not the goddess of war but of his own experience. In the second and third
wisdom, and according to legend, she was paragraphs, Tridon discusses Freud’s inno-
born from her father’s forehead. In the next vations, but the first paragraph seems to

134
 –M C AT ® E X A M P R A C T I C E T E S T 1–

offer a defense of Freud as an observer, a 37. d. In the passage, Jacobs discusses examples of
statistician, and a collector of information the Greeks’ understanding of world geogra-
who did not simply “invent” but created phy, as well as their influences and the
theory based on evidence. Tridon does not sources of their knowledge. Joseph Jacobs
discuss how Freud dealt with criticism, so it begins his discussion with the poems of
does not seem that the passage would be a Homer but moves on from there to discuss
response to this accusation. The accusation Greek colonization and maps. Jacobs dis-
leveled in choice d is tantamount to saying cusses the influences the Babylonians had on
Freud was on drugs so his theories should be the Greeks but still attributes the invention
discarded. It does not go so far as to accuse of map drawing to a Greek philosopher,
Freud of “inventing” his theory based on Anaximander. Jacobs in no way “denounces”
hallucinations. If Tridon’s explanation of Greek colonization but rather discusses the
Freud’s “scientific method” in the first para- facts of it without offering judgment on its
graph were in response to this accusation, he rightness or wrongness.
would probably have paid closer attention to 38. c. Within the context of the sentence, the word
Freud’s own mental clarity. “navel” means “center.” Jacobs is primarily
36. c. Tridon discusses the relationship between discussing location at this point. The word
sleeping states and waking states and the “navel” may be confused with “naval,” which
universality of dream symbols. If three peo- has to do with warships. Jacobs does not dis-
ple have the same dream, it is likely because cuss how Greek colonies were dependent on
the symbolism of the dream is universal and Delphi, as the term “lifeline” suggests, but
the dream indicates something going on in rather their concept of the entire world
their daily lives. Tridon mentions Freud’s beyond Greece, and he does not discuss the
idea that symbolic actions of the “mentally origin of Greek civilization but rather their
insane” mirror symbolic dream actions— early concepts of geography.
which would suggest that an insane person
might show up nude in inappropriate places
in his or her waking life, rather than that the
three dreamers suffer a mental illness.
Choice b refers to Freud’s theory of “wish
fulfillment,” but the passage also emphasizes
that bizarre dream occurrences are actually
symbolic, so being naked in a dream may
actually have a symbolic meaning rather
than express the literal desire to be an exhi-
bitionist. Finally, Tridon discusses Freud’s
ideas that there is a universal symbolic
dream language but at no point suggests that
dreamers are psychically linked.

135
 –M C AT ® E X A M P R A C T I C E T E S T 1–

39. d. The author says that Homer describes the 41. c. Jacobs emphasizes that the Greeks were best
location of pygmies—people who had been known for their curiosity, and it is this qual-
considered fictional until anthropologists ity that led them to obtain and record geo-
later confirmed this knowledge. This graphical information. Jacobs discusses the
strengthens the use of a poem as a means of Greek colonies without reference to war or
discovering historical geographical knowl- any details of the colonization except for the
edge regarding the areas Homer actually location of the colonies and does not men-
knew, i.e., “Northern Greece and of the west- tion the richness of the Greeks or sponsored
ern coasts of Asia Minor, some acquaintance explorations. And while he discusses the
with Egypt, Cyprus, and Sicily.” Jacobs does Greeks’ conception of the location of the
not bring up the work of anthropologists in ocean, he does not discuss their access to
order to reach the conclusion that aspects of ocean routes as affecting their ability to
fables are real but rather to show that aspects explore.
of the work of Homer were factual, even 42. c. Russell initially calls into question the cer-
when they had been disregarded as fabulous tainty of observations and assumed facts,
for a long time. And he does not object to discussing the difficulty of determining any-
applying the term “discovery” to a people, as thing to be “true.” The color of the table is
the anthropologists were described as redis- an example used to elucidate Russell’s ideas
covering the pygmies. Finally, from the con- about appearance and reality. Determining
text it is not clear that people regarded the true color is not really Russell’s purpose.
Homer as the creator of this fable. Further- In the final paragraph Russell discusses these
more, the mention of the anthropologists differences, but in the initial paragraphs he
focuses on the fact that something consid- does not. The painter is used as an example
ered fabulous actually turned out to be true. of a way one might see the world, and the
40. a. If the oldest map of the world contained a overall discussion focuses on perception
cuneiform inscription, then it was not versus reality. And while Russell discusses
drawn by the Greek “inventor of map- the practical, he does not mention the
drawing.” Thus, mapmaking can possibly fantastical.
not be claimed as his “invention.” (However, 43. c. In paragraph 2, Russell discusses how light
Jacobs possibly intended to go into the sub- changes the distribution of color on the
tleties between cuneiform inscription, which table as a person moves. Choice a is similar
involves using stick-like tools in clay, and to what Russell discusses in the first
“drawing,” which more traditionally refers to paragraph—doubting perception and what
some kind of pigment on paper.) Choice b can be an agreed-upon fact—but the
would appear to strengthen Jacobs’s final discussion of the table color is in paragraph
sentence inasmuch as providing a reason for 2, while Russell does not discuss the
a culture’s invention of map-drawing, while psychology of the viewers or how medical
choice c is irrelevant to the final sentence of conditions affect perception.
the passage, and though Homer’s concept of
the world predates the first maps, it is an
example of geographical knowledge that can
be recorded without a map, so it does not
really contradict Jacobs’s statement.
136
 –M C AT ® E X A M P R A C T I C E T E S T 1–

44. b. The author takes pains to discuss different 46. c. Russell’s main point about the color of the
points of perception but does not doubt the table is that it changes with the viewer’s per-
person who perceives that these things really spective. This would be that case with the
exist. While the author’s language often table’s shape as well—the angles of the four
refers to men, the discussion is not actually corners would look different at different
gendered. This might be an appropriate crit- points in the room. Russell brings up the
icism of his word choice but not really of his example of the painter in the last paragraph
argument. Meanwhile, choice c is dismissive as someone who is really looking at the
of the author but does not actually tackle the table, attempting to copy exactly what he
argument he tries to make, and considering sees, disregarding “common sense” that says
the table as a collection of atoms is another the table is brown (or in the case of this
perspective on the table, which the author question, a rectangular shape), but he does
could use to bolster his doubt. not conclude that the artist is able to deter-
45. b. In the search for “certainty,” Russell lists sev- mine the “true” nature of the table. Rather,
eral observable facts in front of him but he concludes that the artist captures only
most likely references the specific distance to what “seems” to be. The practical human
the sun to establish that even agreed-upon would likely want to know what shape the
scientific data is called into question. The table really is, just as he wanted to know
distance to the sun is not really relevant to about its color, and Russell doubts the sense
the discussion of a person’s perception of of touch as much as the sense of sight. The
light reflecting off a table, and Russell does first paragraph demonstrates that doubt sur-
not connect the two things, and while rounds accepted facts of science and all
Russell wants to establish things that any appearances around him, including that he
“normal” observer would agree with, the fact feels the table pressing against his arm.
is not used to establish his own authority 47. a. Option I sounds logical, but it would contra-
but rather to pick a fact that anyone might dict Russell’s argument most directly. He
agree on. Finally, Russell does not define brings up differing points of view of a single
“normal” perception but takes that as a object as problematic, rather than as proof it
given. The distance to the sun alludes to exists. Option III concludes that we can
another type of perception (i.e., that of the know something is true, which Russell
telescope), but he does not connect that with would certainly not agree with, since he con-
the painter’s perception. tinually questions whether we can truly
know something. Choice b fits with what
Russell is saying, so it is not a contradiction,
whereas choice c contradicts Russell’s state-
ments, but is not the only option that con-
tradicts him. Given Russell’s statements
about certainty, Option IV, which questions
the very concept of certainty, does not con-
tradict his arguments but rather opens up
his discussion. Option II does not contradict
the author’s argument, either.

137
 –M C AT ® E X A M P R A C T I C E T E S T 1–

48. b. From the context of the sentence, a combus- 51. b. Müller consistently advocates for the belief
tive nature is a sign of language that has not that dialects feed and shape languages that
been “arrested by any literary interference.” have risen to prominence. Elsewhere, Müller
Once the language becomes written, it is in a argues that literature arrests a language’s
fixed form. If it is only spoken, then it may development and does not ever mention
constantly change and breed new dialects. transcribing dialects as a practice, does not
From the context of the sentence, Müller’s use the term “logic” or appear to be tracing
meaning is the opposite of choice a, there is the rise of certain words’ popularity—he
no mention of the effectiveness of commu- rather discusses language and dialect in a
nication of different types of languages, and broader sense—and wishes to undercut the
while choice d might be a synonym for com- idea that dialects are merely corruptions of a
bustion in another context, when “explosive” literary language, so it is unlikely that this is
is applied to the term “language,” it usually the term he sets out to define.
means “strong” language or “bad” language, 52. c. Müller specifically says in the first paragraph
which Müller does not mean. that in order to gain insight into the growth
49. b. There are several examples in the passage of languages, we must study the dialects of
that pit dialects against literary language. tribes who have no written language. Müller
Müller’s use of the word “tyranny” suggests does not advocate that linguists should study
strongly that literary language has wrong- dead languages but insists that a historian of
fully taken prominence over the language of language should study the literary languages
dialects. In the context of the passage, choice he terms “dynasties” in addition to dialects.
a does not really suggest bias; it is neither He also uses the term “corruption” to
negative nor positive. Choice c refers to liter- describe a specific type of dialect, not to
ary languages, but not in a negative way, and object to the term but rather to support the
choice d refers to dialects, not literary idea that all dialects are corruptions. The
language. study of literature is irrelevant to the
50. c. This is the correct answer. Müller cites passage.
Grimm in order to critique him and demon- 53. b. Müller describes dialects as feeders and
strate why he believes quite the opposite— streams that run parallel to literary language.
that dialects are the “feeders rather than the Müller does emphasize the growth of
channels” of literary languages. The theories language, but choice a sounds similar to how
in choice a sound similar, but his theory isn’t Grimm conceives of dialects—that the
necessarily discredited, even if was inspired multiplicity of dialects stem from a unified
by the theory of evolution. The theory is language—and Müller does not agree.
possibly vulnerable to the criticism in choice Müller also emphasizes the changing nature
b, but it is a debatable claim. Finally, of dialects, which runs counter to the idea of
Grimm’s theory depends on the idea that a them being “firm” and “fixed,” and does not
greater number of dialects are presently spo- emphasize the idea that dialects are indistin-
ken, as it posits, “the more we look backward guishable from a larger language or are
in the history of language the smaller.” static, like sand on a beach.

138
 4 MCAT EXAM ®
c h a p t e r

PRACTICE
TEsT 2

CHAPTER SUMMARY
This is the second of two practice MCAT® exams.

T he exam is organized in four sections:

n
Biological and Biochemical Foundations of Living Systems
Chemical and Physical Foundations of Biological Systems
Psychological, Social, and Biological Foundations of Behavior
n Critical Analysis and Reasoning Skills

(Note: you will have access to the Periodic Table of Elements during the exam.)

This practice test is modeled on the content, format, and length of the official MCAT® exam. At the begin-
ning of each section you’ll find the number of questions and the time allotted. We recommend that you take the
test under timed conditions so you can get an accurate assessment of how you might do on test day and deter-
mine the pace you’ll need to work at.
Use your results on each section of the exam to determine your strengths and weaknesses and guide your
study. Good luck!

139
To access online MCAT practice that provides instant scoring and feedback:
• Navigate to your LearningExpress platform and make sure you’re logged in.
• Search for any of the following tests, select your chosen test, and then click “Start Test.”
• MCAT Practice Test 1: Critical Analysis and Reasoning Skills
• MCAT Practice Test 1: Chemical and Physical Foundations of Biological Systems
• MCAT Practice Test 1: Psychological, Social, and Biological Foundations of Behavior
• MCAT Practice Test 1: Biological and Biochemical Foundations of Living Systems
 –L E A RNIN G E X P R E s s A N s W E R s HE E T –

Part 1: Biological and Biochemical Foundations of Living systems

1. a b c d 21. a b c d 41. a b c d
2. a b c d 22. a b c d 42. a b c d
3. a b c d 23. a b c d 43. a b c d
4. a b c d 24. a b c d 44. a b c d
5. a b c d 25. a b c d 45. a b c d
6. a b c d 26. a b c d 46. a b c d
7. a b c d 27. a b c d 47. a b c d
8. a b c d 28. a b c d 48. a b c d
9. a b c d 29. a b c d 49. a b c d
10. a b c d 30. a b c d 50. a b c d
11. a b c d 31. a b c d 51. a b c d
12. a b c d 32. a b c d 52. a b c d
13. a b c d 33. a b c d 53. a b c d
14. a b c d 34. a b c d 54. a b c d
15. a b c d 35. a b c d 55. a b c d
16. a b c d 36. a b c d 56. a b c d
17. a b c d 37. a b c d 57. a b c d
18. a b c d 38. a b c d 58. a b c d
19. a b c d 39. a b c d 59. a b c d
20. a b c d 40. a b c d

Part 2: Chemical and Physical Foundations of Biological systems

1. a b c d 21. a b c d 41. a b c d
2. a b c d 22. a b c d 42. a b c d
3. a b c d 23. a b c d 43. a b c d
4. a b c d 24. a b c d 44. a b c d
5. a b c d 25. a b c d 45. a b c d
6. a b c d 26. a b c d 46. a b c d
7. a b c d 27. a b c d 47. a b c d
8. a b c d 28. a b c d 48. a b c d
9. a b c d 29. a b c d 49. a b c d
10. a b c d 30. a b c d 50. a b c d
11. a b c d 31. a b c d 51. a b c d
12. a b c d 32. a b c d 52. a b c d
13. a b c d 33. a b c d 53. a b c d
14. a b c d 34. a b c d 54. a b c d
15. a b c d 35. a b c d 55. a b c d
16. a b c d 36. a b c d 56. a b c d
17. a b c d 37. a b c d 57. a b c d
18. a b c d 38. a b c d 58. a b c d
19. a b c d 39. a b c d 59. a b c d
20. a b c d 40. a b c d

141
 –L E A RNI N G E X P R E s s A N s W E R s HE E T –

Part 3: Psychological, social, and

Biological Foundations of Behavior
1. a b c d 21. a b c d 41. a b c d
2. a b c d 22. a b c d 42. a b c d
3. a b c d 23. a b c d 43. a b c d
4. a b c d 24. a b c d 44. a b c d
5. a b c d 25. a b c d 45. a b c d
6. a b c d 26. a b c d 46. a b c d
7. a b c d 27. a b c d 47. a b c d
8. a b c d 28. a b c d 48. a b c d
9. a b c d 29. a b c d 49. a b c d
10. a b c d 30. a b c d 50. a b c d
11. a b c d 31. a b c d 51. a b c d
12. a b c d 32. a b c d 52. a b c d
13. a b c d 33. a b c d 53. a b c d
14. a b c d 34. a b c d 54. a b c d
15. a b c d 35. a b c d 55. a b c d
16. a b c d 36. a b c d 56. a b c d
17. a b c d 37. a b c d 57. a b c d
18. a b c d 38. a b c d 58. a b c d
19. a b c d 39. a b c d 59. a b c d
20. a b c d 40. a b c d

Part 4: Critical Analysis and Reasoning skills

1. a b c d 19. a b c d 37. a b c d
2. a b c d 20. a b c d 38. a b c d
3. a b c d 21. a b c d 39. a b c d
4. a b c d 22. a b c d 40. a b c d
5. a b c d 23. a b c d 41. a b c d
6. a b c d 24. a b c d 42. a b c d
7. a b c d 25. a b c d 43. a b c d
8. a b c d 26. a b c d 44. a b c d
9. a b c d 27. a b c d 45. a b c d
10. a b c d 28. a b c d 46. a b c d
11. a b c d 29. a b c d 47. a b c d
12. a b c d 30. a b c d 48. a b c d
13. a b c d 31. a b c d 49. a b c d
14. a b c d 32. a b c d 50. a b c d
15. a b c d 33. a b c d 51. a b c d
16. a b c d 34. a b c d 52. a b c d
17. a b c d 35. a b c d 53. a b c d
18. a b c d 36. a b c d

142
 –M C AT ® E X A M P R A C T I C E T Es T 2 –

IA VIIIA
1
H
Periodic Table 2

IIA IIIA IVA VA VIA VIIA He

3 4 of Elements 5 6 7 8 9 10
Li Be B C N O F Ne
11 12 13 14 15 16 17 18
Na Mg IIIB IVB VB VIB VIIB VII IB IB Al Si P S Cl Ar
19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36
K Ca Sc Ti Y Cr Mn Fe Co Ni Cu Zn Ga Ge As Se Br Kr
37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54
Rb Sr Y Zr Nb Mo Tc Ru Rh Pd Ag Cd In Sn Sb Te I Xe
55 56 57 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86
Cs Ba *La Hf Ta W Re Os Ir Pt Au Hg Tl Pb Bi Po At Rn
87 88 89 104 105 106 107 108 109 110
Fr Ra +Ac Rf Ha 106 107 108 109 110

*Lanthanide 58 59 60 61 62 63 64 65 66 67 68 69 70 71
*Series Ce Pr Nd Pm Sm Eu Gd Tb Dy Ho Er Tm Yb Lu
+Actinide 90 91 92 93 94 95 96 97 98 99 100 101 102 103

+Series Th Pa U Np Pu Am Cm Bk Cf Es Fm Md No Lr

Legend
H – gas Li – solid Br – liquids Tc – synthetic

Non-Metals Transition Metals Rare Earth Metals Halogens

Alkali Metals Alkali Earth Metals Other Metals Inert Elements

143
 –M C AT ® E X A M P R A C T I C E T E S T 2–

from the cell. However, when the cell encounters

Part 1: Biological and
stress, such as DNA damage or the activation of an
Biochemical Foundations
oncogene, another pattern of PTM confers the
of Living systems
stabilization of p53. Under these conditions,
ubiquitination is suppressed, and p53 is instead
acetylated and phosphorylated; both of these
95 Minutes
modifications stabilize the protein. P53 primarily
59 Questions
functions as a transcriptional activator or repressor,
and its target genes are involved in cell cycle arrest,
Use the following passage to answer questions 1
apoptosis, and DNA repair. It accomplishes these
through 4.
functions in homotetrameric complexes, and
phosphorylation of p53 has additionally been
Very few proteins carry out their functions in the cell
demonstrated to increase the complex’s sequence-
as unmodified folded polypeptides. Nearly all
specific binding to DNA. PTMs are dynamic;
proteins undergo post-translational modifications
phosphorylation, which often occurs in the cytosol,
(PTMs) in various cellular compartments, including
is controlled by kinase enzymes, whereas removal of
the cytosol, Golgi apparatus, and endoplasmic
phosphate groups is carried out by another set of
reticulum. One common modification type is
enzymes called phosphatases. Similarly, while histone
proteolytic cleavage, which involves irreversible
acetyltransferases add acetyl groups to p53, histone
processing of a polypeptide by proteases. Another
deacetylases remove them. P53 has also been shown
major category of PTMs is covalent modification of
to undergo additional PTMs: neddylation, which
specific amino acid residues. Among the many
could repress its transactivator activity; sumoylation,
examples of these modifications are
which could act like ubiquitination; glycosylation;
phosphorylation, acetylation, methylation, and
and ribosylation. The importance of p53 in cancer
glycosylation. There is evidence that every amino
formation is illustrated by the fact that more than
acid residue can be decorated with one or more of
20,000 mutations in the protein have been found in
these modification groups. The specificity of this
various cancer types. Many mutations lie in the p53
type of PTM is partially determined by the pattern of
DNA binding domain and give rise to oncogenic
amino acids surrounding the target residue. Because
properties. Additionally, mutations often result in
PTMs affect myriad properties of proteins, including
increased phosphorylation and acetylation and, thus,
stability, localization, and interaction with other
stabilization of these oncogenic forms of p53.
proteins, there has been intense effort in biological
research to characterize the PTMs of individual
1. Which of the following post-translational
proteins and protein populations in the cell. The
modifications is most likely to mark a protein
influence of PTMs on protein function is illustrated
for degradation?
by the example of p53, a canonical tumor suppressor
a. Monoubiquitination
protein. The levels of p53 in mammalian cells are
b. Polyubiquitination
tightly regulated by a modification called
c. Acetylation
ubiquitination. Under normal conditions, the
d. Neddylation
addition of multiple ubiquitin groups to p53 results
in the sequestration of the protein into the 26S
proteasome complex and its consequent clearance

145
 –M C AT ® E X A M P R A C T I C E T E S T 2–

2. Which of the following is a property of the there are numerous treatment options for type 2
cellular compartment where protein diabetes, none of them allow for long-lasting control
phosphorylation often occurs? of blood glucose in most patients. Glucokinase, also
a. It is aqueous. known as hexokinase IV, is expressed in the liver and
b. It is usually only found in eukaryotes. mediates the clearance of glucose from the blood
c. It has a pH of 6.5. through at least two different mechanisms. First, it
d. It precipitates away from the other cellular catalyzes the phosphorylation of glucose to glucose
compartments by high-speed centrifugation. 6-phosphate. Other forms of hexokinase (hexokinase
I, II, III) catalyze the same reaction in other cells of
3. Which of the following is NOT a true the body, such as muscle cells. Second, glucokinase
similarity between covalent modifications and controls the levels of glucose by regulating the
proteolytic cleavage? conversion of glucose to the storage form of
a. Both processes affect the cellular function of glycogen. There is also evidence that glucokinase acts
proteins. as a glucose sensor in pancreatic cells, where it is
b. Both processes are controlled by enzymes. differentially expressed in response to glucose. These
c. Both processes are reversible. research observations led to speculation that
d. Both processes affect protein localization. glucokinase might be an important determinant of
the diabetes phenotype. Indeed, family studies in the
4. Which method would likely NOT allow for the 1990s revealed that mutations associated with
detection of different modification states of a reduced glucokinase activity were associated with a
protein? form of diabetes known as maturity onset diabetes of
a. Deletion of an amino acid that bears the the young (MODY). Furthermore, there is evidence
modification that inactivating mutations act in a dose-dependent
b. Mass spectrometry fashion: mutations in a single allele are linked to
c. 2D gel electrophoresis mild hyperglycemia, whereas homozygous mutations
d. Restriction enzyme digest are linked to severe permanent diabetes in the
neonatal stages. On the other hand, activating
5. Which of the following amino acids is typically mutations have been found to cause hypoglycemia.
modified with a phosphate group? The discovery of an allosteric site in glucokinase
a. Proline outside of its active site paved the way for the
b. Serine development of enzymatic activators starting in the
c. Tryptophan early 2000s. In a recent study of patients with type 2
d. Valine diabetes, one such activator was found to lower
blood glucose. To date, numerous glucokinase
Use the following passage to answer questions 6 activators have been developed, and their amino acid
through 10. sequence may help lead to the identification of
endogenous activators of the enzyme. In contrast,
Glucokinase possesses several properties that make it there is a physiologic negative allosteric effector of
an attractive target for type 2 diabetes therapy, and glucokinase, called fructose 6-phosphate, which is a
several activators of the enzyme are currently being product of the glycolytic pathway downstream of
developed as potential drug candidates. Although glucose 6-phosphate. Fructose 6-phosphate causes

146
 –M C AT ® E X A M P R A C T I C E T E S T 2–

glucokinase to bind more tightly to a regulatory 10. Based on the following graph, how do the
protein that sequesters the enzyme in the nucleus Michaelis-Menten kinetics of hexokinase I and
when blood glucose is low. However, when blood glucokinase differ from each other?
glucose is in the normal range, glucokinase
dissociates from this regulatory protein, helping to
keep the levels of glucose in the appropriate 1.0
physiological range. Hexokinase I

Relative enzyme activity

6. Within the glycolytic pathway, glucokinase
catalyzes
a. the first step.
b. the second step.
c. the sixth step. Hexokinase IV
(glucokinase)
d. the tenth (and final) step.

7. How are hexokinase I and glucokinase

(hexokinase IV) related to each other?
a. They are homologs. 0 5 10 15 20
b. They are orthologs. Glucose concentration (mM)
c. They are coenzymes.
d. They are isozymes. a. Hexokinase I has a higher Km for glucose
than glucokinase.
8. In addition to glycolysis, hepatic glucokinase b. Glucokinase has a higher Km for glucose
also plays a key role in than hexokinase I.
a. glycogenolysis. c. Hexokinase I has a higher Vmax for glucose
b. glycogenesis. than glucokinase.
c. gluconeogenesis. d. Glucokinase has a higher affinity for glucose
d. fermentation. than hexokinase I.

9. Which of the following is NOT true about Use the following passage to answer questions 11
allosteric effector molecules? through 13.
a. They bind their substrate protein outside of
its active site. An operon is a cluster of contiguous genes controlled
b. They induce a conformational change in by a single promoter and a regulatory element called
their substrate. the operator, which usually lies downstream from the
c. They interact with their substrate through promoter. The genes in an operon typically have
covalent binding. related functions. The classic example of an operon,
d. They can either activate or repress and the first to be characterized, is the lac operon in
depending on the effector-substrate pair. E. coli. The lac operon is composed of a promoter
element (P); three operators (Os), termed O1, O2,
and O3; and three genes, lacZ, lacY, and lacA, which

147
 –M C AT ® E X A M P R A C T I C E T E S T 2–

encode, respectively, b-galactosidase, b-galactoside 12. Which type of operon is the lac operon?
permease, and b-galactoside transacetylase. Outside a. Positive inducible
of the operon, the I gene encodes the lac repressor; in b. Negative inducible
the absence of lactose, the lac repressor, as a c. Repressible
tetrameric complex, binds the operators, blocking d. Constitutive
RNA polymerase transcription of lacZ, lacY, and
lacA. As a result, these genes are expressed at low 13. What is the predicted effect of the following
levels, giving rise to a baseline amount of enzymatic genotype on expression of lacZ, lacY, and lacA
activity. However, when lactose is present outside the (where + signifies wild-type)?
cell, the baseline level of b-galactoside permease I+ P+ O– lacZ+ lacY+ lacA+
_____________________
pumps lactose into the cell, and b-galactosidase I+ P+ O+ lacZ– lacY– lacA–

converts it to allolactose. Allolactose binds the a. There would be constitutive expression of

repressor, resulting in its release from the operators. the genes.
In this way, the lac operon is controlled by a positive b. There would be repressed (baseline)
feedback: lactose increases expression of lacZ and expression of the genes.
lacY, which in turn increases the uptake of lactose c. There would be no expression of the genes.
into cells. However, other energy sources also affect d. There would be no effect on the expression
the induction of the lac operon. In the presence of a of the genes.
glucose, which is a more efficient energy source than
lactose, the lac operon is repressed through a Use the following information to answer questions
regulator protein called catabolite activator protein 14 through 16.
(CAP) and cyclic AMP (cAMP). The components of
the lac operon were all originally identified through A method termed rapid amplification of cDNA ends
mutations, such as in the I gene (I–), the promoter (RACE) was developed in the late 1980s to allow for
(P–), and the operator elements (O–) that affected the easy and fast generation of full-length
expression of lacZ, lacY, and lacA. complementary DNA (cDNA) copies of low-
abundance messenger RNA molecules (mRNAs). In
11. Which of the following statements about the first step, which relies on a unique property of
operons is NOT true? mRNA, reverse transcriptase is employed to produce
a. They are present in both prokaryotes and negative-strand cDNA from mRNA. This strand then
eukaryotes. serves as a template for the production of positive-
b. The promoter and operon can overlap. strand cDNA. Finally, polymerase chain reaction
c. Genes in an operon are coordinately (PCR) of the two strands results in the amplification
transcribed. of cDNA. The RACE method can be used in
d. The proteins encoded by genes in an operon situations where only a partial sequence of mRNA is
are always produced at equal molar levels. known and also to identify alternative gene
transcripts. The technique can also be modified to
create cDNA libraries from a pool of mRNA
molecules.

148
 –M C AT ® E X A M P R A C T I C E T E S T 2–

The following figure illustrates the RACE 15. How is RACE different from PCR?
method: a. It requires a set of primers that are
complementary to the nucleotide templates.
b. It requires dNTPs to synthesize new DNA
strands.
c. It involves multiple cycles of denaturation,
annealing, and elongation.
d. It requires the reverse transcriptase enzyme.

16. Which of the following methods would NOT

allow for the detection of alternatively spliced
transcripts after conducting RACE?
a. 2D gel electrophoresis
b. Cloning and sequencing
c. Northern blotting
d. Southern blotting

Use the following information to answer questions

17 through 20.

Genes that are located on different chromosomes

assort independently. However, genes on the same
chromosome can still separate from each other
through a process called recombination. During
meiosis, when four homologous chromatids form a
M. A. Frohman et al. Rapid production of full-length cDNAs from
rare transcripts: amplification using a single gene-specific oligo- tetrad, two of the chromatids can cross over, which
nucleotide primer. Proc Natl Acad Sci. 1988;85(23):8998–9002. causes them to break from their chromatid and
reattach to the other chromatid. When this crossover
14. Based on the figure, the RACE method relies event happens between non-sister chromatids that
on which of the following mRNA contain different alleles of a gene, recombination
modifications? takes place and gives rise to genetic diversity.
a. 5' capping Furthermore, the event can happen at more than one
b. Splicing point between chromatids, resulting in multiple
c. Polyadenylation crossovers. Evidence of crossovers can be seen
d. Editing microscopically by the detection of chiasmata. These
structures are thought to remain at the site of
crossovers because the chromatids stay tangled
together as the cell continues through meiosis. In
addition to the detection of chiasmata, geneticists

149
 –M C AT ® E X A M P R A C T I C E T E S T 2–

can identify crossover events by tracking the 18. The table below shows the number of progeny
recombination of alleles on either side of the from a cross between a Drosophila female that
chromatid exchange. This tracking also allows the is heterozygous for three X-linked genes—a
mapping of distance between genes. There is a direct wing gene called crossveinless (cv), an eye gene
correlation between the extent of recombination called echinus (ec), and bristle gene called
between two linked genes and their distance from scute (sc)—with a male that has a mutant copy
each on a chromosome: genes that are far apart of each gene on his X chromosome. The genes
recombine frequently. The rates of recombination are named for the phenotypes associated with
can also reveal the order of genes on a chromosome their mutant forms. Because the wild-type
because single crossover events are much more likely (WT) genes are dominant, the female exhibits
to occur than multiple crossover events. normal wings, eyes, and bristles; the male has
the crossveinless, echinus, scute phenotypes.
17. In a cross between a heterozygous Drosophila Based on the frequency of phenotypes among
female (AB/ab) and a homozygous male the progeny, what is the order of the genes on
(ab/ab), the frequency of progeny is as follows: X chromosome?
37 AB/ab, 46 ab/ab, 11 aB/ab, 7 Ab/ab. Based
on these frequencies, what is the distance in NuMBER oF
centimorgan (cM) between genes a and b? PHENoTyPE PRoGENy
a. 4 cM wild-type 1,455
b. 7 cM crossveinless, echinus, scute 1,158
c. 11 cM
crossveinless 148
d. 18 cM
echinus, scute 192
crossveinless, echinus 130
scute 163
crossveinless, scute 1
echinus 1

a. cv-ec-sc
b. cv-sc-ec
c. ec-sc-cv
d. sc-ec-cv

19. During which stage of meiosis does crossover

between homologous chromosomes occur?
a. Prophase of meiosis I
b. Metaphase of meiosis I
c. Prophase of meiosis II
d. Metaphase of meiosis II

150
 –M C AT ® E X A M P R A C T I C E T E S T 2–

20. The two images below are of a chromosome Use the following information to answer questions
pair, stained either with DAPI (to visualize the 21 through 25.
DNA) or HTP-3 (to visualize chromosomal
axes), in wild-type C. elegans (top image) or in HIV type 1 is one of several sexually transmitted
animals in which a protein that plays an infections, along with human papillomavirus and
important role in resolving crossovers, syp-1, herpes simplex virus 2, that disproportionately
was depleted (bottom image). affects women. Young women are an especially
vulnerable population and represent more than 25%
of new infections. In sub-Saharan Africa, which is the
epicenter of the global HIV epidemic, women
account for approximately 60% of people living with
HIV. In addition to gender inequalities, there are
biological factors that put women at a higher risk of
being infected with HIV and change the course of
disease, including anatomical and hormonal
differences and X and Y chromosome–linked genes.
Women actually have lower viral load and higher
CD4+ T-cell count than men in both acute and
chronic infection; however, despite these factors,
women experience faster disease progression and are
more likely than men to develop AIDS. One of the
major determinants of disease progression is
immune activation. Plasmacytoid dendritic cells
(pDCs) detect HIV-1 RNA via cell-surface molecules
called Toll-like receptors (TLRs), of which there are
about a dozen types in mammals. TLR-3, -7, and -8
recognize molecular patterns in RNA viruses,
whereas TLR-4, -5, and -9 generally recognize ligands
http://openi.nlm.nih.gov/detailedresult.php?img=3920622_ present in bacteria. In response, pDCs produce
nihms-516707-f0001&query=chiasma&it=xg&req=4&npos=28.
interferon-a (IFN-a), an antiviral cytokine
Based on the images, what is the difference in molecule. Studies have reported that pDCs derived
the number of chiasmata between the WT and from women produce more IFN-a following
syp-1–depleted animals? exposure to HIV-1 than cells from men.
Furthermore, one study found that a type of estrogen
a. The WT image has one more chiasmata than
hormone, called 17-beta-estradiol, could boost the
the syp-1–depleted image.
response of pDCs to HIV-1 exposure, which in turn
b. The syp-1–depleted image has four more
could help mount a stronger immune response. The
chiasmata than the WT image.
superior immune activation could, however, lead to a
c. The syp-1–depleted image has five more
larger burden of non–AIDS-related disease, such as
chiasmata than the WT image.
premature aging, in HIV-infected women, compared
d. The WT and syp-1–depleted images have the
with men. Studies based on large health registries
same number of chiasmata.

151
 –M C AT ® E X A M P R A C T I C E T E S T 2–

suggest that the increased risk of myocardial infarc- 22. Scientists can experimentally determine
tion associated with HIV-1 infection is greater for whether TLR types 7 and 9 are important for
women than it is for men. More generally, sex-based stimulating IFN-a production by exposing
differences in immune stimulation and the inter- cells to agonists of TLR7 or TLR9, called R848
feron-alpha response could put women at higher risk and CpG, respectively. Based on the following
of various chronic and autoimmune diseases. Treat- graph, what can be concluded about the roles
ment with antiretroviral therapy (ART) appears to of TLR7 and TLR9?
benefit women and men equally, although there are
gender and racial differences in likelihood of starting A B CpG = Population 1
R848 = Population 1
ART. In addition, there are sex-based differences in 3,000 10,000
the frequency of adverse events associated with ART,
with women being at higher risk of developing nau- 1,000
sea, skin rash, and other problems, while men are 800
7,500
more likely to experience nausea and sleep
600
difficulties.
500
21. Which of the following statements about 5,000
interferons is NOT true? 400

a. Interferon-a and -b are type I (antiviral)

300
interferons.
b. Plasmacytoid dendritic cells are a specialized 2,500
200
cell type for producing interferon-a and -b.
c. Interferon- is expressed in skin cells in 100

response to viral infection.

0 0
d. Interferon-γ is a type II interferon that does N = 59 61 N = 59 61
female male female male
not have antiviral properties.
B. Berghöfer et al. TLR7 ligands induce higher IFN-alpha produc-
tion in females. J Immunol. 2006;177(4):2088-2096.
Copyright 2006. The American Association of Immunologists,
Inc.

a. The increased production of IFN-a in

females compared with males is dependent
on TLR7.
b. The increased production of IFN-a in
females compared with males is dependent
on TLR9.
c. The increased production of IFN-a in males
compared with females is dependent on TLR7.
d. The increased production of IFN-a in
females compared with males is inhibited by
TLR7.

152
 –M C AT ® E X A M P R A C T I C E T E S T 2–

23. The progesterone hormone has been shown to 24. Based on the table of hazard ratios (HRs) of
modulate the production of IFN-a in response time to initiation of ART, what conclusion can
to exposure to HIV-1 genomic RNA. Based on be made about the likelihood that the different
the following graph, which group of women groups will start therapy?
would mount the strongest innate immune
response to HIV-1 infection? RACE ANd sEX HR 95% CI P VALuE
White men 1.0 Reference Reference
Progesterone (ng mL–1)

r = 0.57 White women 1.38 (1.02–1.96) 0.056

20
P = 0.02
Nonwhite men 0.78 (0.34–0.82) 0.003
15
Nonwhite women 0.45 (0.64–0.88) 0.004
10
a. White men and nonwhite men have similar
5 likelihoods of starting ART.
0 b. White women are significantly more likely
0 20 40 60 80
than white men to start ART.
Percentage IFN-α+ pDC
following GagRNA1166 stimulation
c. Nonwhite women are significantly less likely
than white men to start ART.
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2821111/. d. Nonwhite men and women have similar
likelihoods of starting ART.
a. Postmenopausal women
b. Women who have stopped taking
25. Which of the following diseases would NOT be
combination birth control
predicted to disproportionately afflict women
c. Women in the luteal phase of their
compared with men due to their stronger
menstrual cycle
IFN-a response?
d. Women in the follicular phase of their
a. Cardiovascular disease
menstrual cycle
b. Hepatitis C virus infection
c. Systemic lupus erythematosus
d. Rheumatoid arthritis

Use the following passage to answer questions 26

through 32.

Mitochondria are thought to play a key regulatory

role in the development of neurodegenerative disease
and other age-related pathology. The organelle is the
main source of ATP for the cell and is also involved
in numerous processes, including phospholipid
biosynthesis and calcium signaling. However, the
process that forms ATP, termed oxidative
phosphorylation, requires the transfer of electrons

153
 –M C AT ® E X A M P R A C T I C E T E S T 2–

from food-derived molecules to oxygen and results in Alzheimer’s disease, Parkinson’s disease, and other
in the production of reactive oxygen species (ROS). neurodegenerative disorders. Experimental damage
Indeed, most ROS are due to mitochondrial to the mitochondria is associated with Alzheimer’s-
respiration. An estimated 1% to 2% of oxygen that is like pathology in cells in vitro, such as increased
taken up by the body is turned into these radical amyloid-b peptide levels, and in animal models. A
species. Out of likely necessity, eukaryotic cells have transgenic mouse that is deficient in the mitochon-
evolved ample defense mechanisms to protect drial antioxidant enzyme manganese superoxide dis-
themselves from oxidative damage, including several mutase (MnSOD) developed amyloid-b plaques in
mitochondrial antioxidant factors. Yet cellular insults the brain. Moreover, a number of disease-associated
can overcome the mechanisms for removing these proteins, such as amyloid-b, amyloid precursor pro-
species, resulting in a net gain in ROS. Oxidative tein (APP), and parkin, which is associated with Par-
stress can damage mitochondrial DNA (mtDNA), kinson’s disease, have been found to interact with the
such as by causing double- and single-strand breaks, mitochondria. However, these lines of evidence raise
which are potentially mutagenic. Additional many new questions. For example, it is unclear why
casualties of oxidative damage are mitochondrial certain tissues are affected by mitochondrial muta-
proteins, some of which play important roles in the tions more than others, although it has been specu-
citric acid cycle upstream of oxidative lated that those with the highest energy demand are
phosphorylation and, thus, the generation of ATP. also the most susceptible to genetic aberrations. Fur-
The depletion of ATP associated with ROS can lead thermore, many questions remain about the poten-
to the induction of necrosis or to caspase-mediated tial of antioxidant treatment to affect the prognosis
apoptosis. Several lines of evidence suggest that of age-related pathology. Thus far, clinical trials in
mutations in mtDNA, which may result from which one or several antioxidants are given have
oxidative stress, can cause age-related pathology. reported little benefit. It remains possible that a more
Mice that are genetically engineered to accumulate complex strategy for antioxidant therapy would be
these mutations have phenotypes associated with more beneficial.
early-onset aging: weight loss, alopecia, sarcopenia,
and gonadal atrophy. Furthermore, analyses of the 26. Which of the following factors would NOT be
degenerated tissue in these animals revealed elevated expected to help protect mitochondria from
levels of activated caspase enzymes that are markers oxidative damage?
for apoptosis. There is also mounting evidence that a. MnSOD
oxidative damage, as well as defenses against such b. Staurosporine
damage, is associated with aging. Transcriptional c. Ubiquinone
analysis of postmortem brain samples from d. Vitamin E
individuals ranging from ages 26 to 106 revealed,
starting at around age 40, a decrease in expression of
genes involved in mitochondrial function and an
increase in stress-response, antioxidant, and DNA
repair genes. Beyond normal aging, mitochondrial
mutations and oxidative stress have been implicated

154
 –M C AT ® E X A M P R A C T I C E T E S T 2–

27. The following illustration depicts the final stages of the oxidation of food molecules, including the citric
acid cycle, or Krebs cycle, and oxidative phosphorylation.

CO2
glycolysis ATP + Pi

CITRIC 2e
ACETYL CoA ACID NADH OXIDATIVE O2
CYCLE
CoA NAD+ PHOSPHORYLATION H2O

ATP

In which cellular compartment do these steps 30. Based on the following reaction in oxidative
take place in eukaryotes? phosphorylation depicting the conversion of
a. Cytosol O2 to H2O, which species is the first ROS
b. Endoplasmic reticulum intermediate?
c. Mitochondria O2 → O2− → H2O2 → OH → H2O
d. Nucleus
a. Oxygen
28. Which molecule in the illustration possesses b. Superoxide anion
the highest energy? c. Hydrogen peroxide
a. Acetyl-CoA d. Hydroxyl radical
b. CO2
c. NADH 31. Which experimental tool would help
d. NAD determine whether mutations in mtDNA cause
age-related diseases?
29. Which of the following is NOT a similarity a. Defective mutant in the proofreading
between apoptosis and necrosis? activity of mtDNA polymerase
a. They are both triggered by ROS production. b. Defective mutant in the polymerase activity
b. They both lead to cell death. of mtDNA polymerase
c. They are both mediated by caspase enzymes. c. RNA interference targeting the polymerase
d. They are both associated with a rapid loss of activity of mtDNA polymerase
cell membrane electrochemical potentials. d. RNA interference targeting mitochondrial
transfer RNA (tRNA)

32. Which tissue type is predicted to be the least

likely to develop disease as a result of
mitochondrial mutations?
a. Brain
b. Gastrointestinal
c. Heart
d. Skeletal muscle

155
 –M C AT ® E X A M P R A C T I C E T E S T 2–

Use the following information to answer questions example of coxsackievirus, virions bind first to
33 through 38. apically located cell surface protein, and this binding
weakens the cellular transepithelial resistance (a
The epithelial cells of the oral, digestive, respiratory, measure of polarity) and helps bring the virion to
and urinary tracts are the target cell type of many another entry factor that is normally situated in
viruses, bacteria, and other pathogenic hard-to-reach cell junctions. Following the
microorganisms. These cells are polarized, meaning association with junction proteins, the virion is
their plasma membranes are divided into distinct endocytosed into the cell in a complex that includes
apical (top) and basolateral (bottom) regions that these proteins. Similarly, in the early steps of HCV
feature distinct sets of cell surface proteins. This cell entry, virions bind to receptors that are normally
quality is an important early-defense cellular accessible, and this association results in the
mechanism against infection. For example, several translocation of virions to cell junctions, where they
viruses depend on host factors for cell entry that are are endocytosed. Not surprisingly, the process of
located in a plasma membrane domain to which viral entry appears to disrupt polarity. Although the
circulating viruses do not have access. In addition to disruption is temporary and the epithelium likely
viruses, polarized cells restrict the passage of ions, recovers its polarized state, the loss is responsible for
solutes, and macromolecules across the epithelium. symptoms associated with infection. For example,
Cell polarity is created through the specific sorting, rotavirus is the most common cause of severe
trafficking, and retention of proteins to their appro- gastroenteritis among young children globally. As the
priate membrane domains. Junctions where neighbor- virions enter the gastrointestinal epithelium, they
ing cells interact with each other, via transmembrane disrupt the integrity of cell junctions and the actin
proteins, create barriers that are also essential for cytoskeleton, resulting in increased permeability
polarity. In the complex tissue architecture, the apical across cells. These changes can be induced not just by
domain faces the lumen, whereas the basolateral side virions but also by individual viral proteins and are
is in contact with the extracellular matrix. Actin sufficient to cause diarrhea, the hallmark
filaments, which are part of the cytoskeleton, are characteristic of infection, in mice.
associated with the apical domain; they also help
block viruses from entering the cell and are 33. Which of the following is NOT a major
important for maintaining polarity. The filaments function of actin filaments?
directly interact with the intracellular domain of a. Establish polarity
transmembrane proteins involved in cell junctions. b. Transport organelles across the cell
Given the fact that cell junction proteins are c. Help stabilize microvilli
inaccessible from the extracellular space, it seems d. Defend against viral infection
paradoxical that many viruses, including
coxsackievirus, hepatitis C virus (HCV), and
rotavirus, would specifically require these proteins.
Yet a theme is emerging from years of research:
viruses manage to make their way to junction
proteins in a step-wise cell entry process. In the

156
 –M C AT ® E X A M P R A C T I C E T E S T 2–

34. What is the name of the cell junction where the transmembrane proteins occludin and claudin are local-
ized in the following illustration?

apical

RalA Occludin
PP2A ZO-1,2,3
aPKC MAGI-1,2,3
Rac, Cdc42 MUPP-1 Claudin
Rab3b, Rab13, Rab34 PAR-3
ZONAB PATJ
Sec6, 8 PAR-6 JAM
PTEN

Actin Catalytic PDZ-d

cytoskeleton regulators scaffold CAR

Endocytic regulation,
chromatin structure, & scaffold proteins
transcription α-Cat
β-Cat
p120 E-cadherin
Afadin Nectin
Vinculin
Cell proliferation & Zyxin
differentiation
basolateral

a. Adherens junction 36. Which of the following proteins would NOT

b. Desmosomes be expected to disrupt cell polarity?
c. Gap junction a. Cell junction protein with a defective
d. Tight junction extracellular domain
b. Cell junction protein with a defective actin
35. Which polarized cell domain would HCV and binding site
rotavirus virions be expected to use to enter c. Extracellular fragment of cell junction
their respective host cells? protein expressed in cells
a. HCV: apical; rotavirus: basolateral d. Extracellular fragment of cell junction
b. HCV: apical; rotavirus: apical protein added to cell culture media
c. HCV: basolateral; rotavirus: apical
d. HCV: basolateral; rotavirus: basolateral

157
 –M C AT ® E X A M P R A C T I C E T E S T 2–

37. The following graph shows the results of an 38. Which of the following statements about viral
experiment using molecules that antagonize cell entry through endocytosis is NOT true?
the function of cell surface proteins SRB1 and a. Viruses can use several different endocytic
CD81, which HCV uses to enter cells. The pathways to enter the cell.
y-axis represents the amount of viral infectivity b. The endocytic pathway helps viruses
in the cells. The six bars represent different overcome the actin barrier.
times of additions of the antagonists (from left c. Encapsulation in the endocytic organelle
to right): before addition of virus to the cells, makes it easier for the cell to detect the virus.
at the same time as virus addition, and 15, 30, d. The low pH of the endocytic organelle helps
60, 120, and 240 minutes after virus addition. the virus uncoat for replication.

Use the following information to answer questions

39 through 41.

Prions in the cell are synonymous with disease.

Misfolding of the mammalian prion protein (PrP) is
at the root of the fatal neurodegenerative disease
Anti- Anti-
transmissible spongiform encephalopathies (TSE),
SRB1 CD81 which afflicts humans, cattle, sheep, deer, and other
animals. Prions have also been implicated in
M. Sourisseau et al. Temporal analysis of hepatitis C virus cell
entry with occludin directed blocking antibodies. PLoS Pathog. Alzheimer’s disease. There have been intense efforts
2013;9(3):e1003244. to develop therapies for TSE, based on
Based on the graph, what can be concluded chemotherapeutics and antibodies, that would act by
about the roles of SRB1 and CD81 in HCV modulating the expression and stability of PrP,
host cell entry? although it remains unclear whether the soluble,
properly folded form of PrP has important functions
a. HCV cell entry is step-wise, and the virus in the cell. Despite decades of research on the
binds to CD81 first and then to SRB1. severity of prion-mediated disease in mammals,
b. HCV cell entry is step-wise, and the virus beneficial roles for the prion form of some proteins
binds to SRB1 first and then to CD81. have recently been coming into view. The irreversible
c. HCV cell entry requires SRB1, but CD81 is aggregation of proteins effectively results in robust
only involved after virions have entered the amplification of immune signaling. There is also
cell. evidence that prions could be important for the
d. HCV cell entry requires SRB1, but CD81 is formation of immune memory. Two examples of
not involved. mammalian proteins that could be functional in
their prion form are MAVS and ASC. MAVS
aggregates in response to the highly sensitive binding
of the RIG-I protein to viral RNA inside the cell.
Following binding, RIG-I oligomerizes and activates

158
 –M C AT ® E X A M P R A C T I C E T E S T 2–

MAVS, which in turn leads to the induction of 39. Which of the following would be expected to
antiviral cytokine expression. Several experimental diminish the levels of prions?
findings first suggested that MAVS forms prions: the a. Boiling
protein gathers into complexes that are resistant to b. Cell division
treatment with 2% sodium dodecyl sulfate (SDS), c. Incineration
and the addition of these complexes to recombinant d. Treatment with 2% SDS
MAVS proteins in vitro caused these proteins to form
protease-resistant cores. Furthermore, the MAVS 40. Which of the following properties would be a
prion state can be propagated through cell divisions. benefit of using anti-PrP antibodies to treat
Nevertheless MAVS does stand apart from other prion disease?
typical prions in several ways. For one, their a. Immune tolerance
polymerization leads to gain of function. In addition, b. Ability to distinguish aggregated from
their polymerization is not stochastic but in response soluble PrP
to activation by upstream sensors. Still, the other c. Ability to suppress expression of the PrP
prion-like qualities of MAVS qualify it to be in this gene
group of proteins. Once MAVS is activated by RIG-I, d. Poor transport across the blood-brain
it forms punctate structures in the cell that are barrier
thought to be important for recruiting other proteins
that help propagate its signal. Although MAVS is one 41. In what way are prions and microtubules
of the first gain-of-function prions to be described in similar to each other?
mammalian cells, there is evidence that these types of a. Their polymerization is reversible.
proteins are evolutionarily conserved. For example, b. They are cytoplasmically inherited.
when the fungal protein HET-S protein converts c. They are not functional in their soluble
from soluble to aggregated, it can signal cell death to form.
surrounding cells that do not contain HET-S prions. d. Polymerization is associated with
This finding suggests that prion state could possibly conformational change.
act as a form of memory for the cell of previous
infection or insult. There is speculation that 42. How many molecules of ATP are produced by
mammalian prions could serve a similar function the oxidation of one molecule of glucose?
and help explain the mechanism whereby a. 8
mammalian cells are desensitized to pathogen b. 16
stimulation and other threats. c. 32
d. 64

43. Acute pancreatitis is caused by the inability of

the pancreas to secrete which type of molecule?
a. Bicarbonate
b. Glucose
c. Lipids
d. Zymogens

159
 –M C AT ® E X A M P R A C T I C E T E S T 2–

44. Which of the following reactions would NOT 47. Based on these chemical structures, what is the
be expected to occur spontaneously? single difference between the two steroid
a. H2O (l) → H2O (g) (when the partial hormones?
pressure of water vapor in the air < a. Progesterone has a ketone; testosterone has
0.031 atm) an alcohol.
b. 3O2 (g) → 2O3 (g) b. Progesterone has an alcohol; testosterone has
c. CH4 (g) + 2O2 (g) → CO2 (g) + 2H2O (l) a ketone.
d. 2H2 (g) + O2 (g) → 2H2O (g) c. Progesterone has an aldehyde; testosterone
has an alcohol.
45. Which of the following changes would explain d. Progesterone has an alcohol; testosterone has
a shift in the absorption spectra of a an aldehyde.
flavoprotein from 450 nm to 360 nm?
a. The flavoprotein changed from partially 48. In what conformation are the methyl and
oxidized to fully oxidized. hydrogen groups in the A/B rings of these
b. The flavoprotein changed from fully hormones?
oxidized to partially oxidized. a. cis-cis-cis
c. The flavoprotein changed from partially b. cis-trans-cis
reduced to fully reduced. c. trans-cis-trans
d. The flavoprotein changed from fully reduced d. trans-trans-trans
to partially reduced.
49. Calculate the osmotic pressure of a 0.035-molar
46. How many acetyl-CoA molecules does the fatty solution of nitrous acid at 295 Kelvin, given
acid oxidation of palmitic acid (C16H32O2) that the Van 't Hoff factor of nitrous acid is 1.1
yield? and the gas constant is 0.08206 L atm mol−1
a. 4 K−1.
b. 8 a. 0.63
c. 16 b. 0.77
d. 20 c. 0.85
d. 0.93
Use the following images to answer questions 47 and
48. 50. Which of the following is NOT an oncogenic
cell surface receptor?
The following chemical structures represent a. EGFR
progesterone (left) and testosterone (right). b. ERBB2
c. TIM22
d. VEGF

160
 –M C AT ® E X A M P R A C T I C E T E S T 2–

51. The first step in the biosynthesis of terpenoids 53. Which type of molecule is used for
is the conversion of isopentenyl diphosphate immunostaining?
(IPP) to dimethylallyl diphosphate (DMAPP), a. Antibody
as depicted below. Which type of reaction is b. ICAM
this conversion? c. MHC
d. Synthetic chemical

54. What is the force that it would take for a

http://openi.nlm.nih.gov/detailedresult.php?img=2849937_401_
molecule of sodium to spontaneously go
2009_635_Fig4_HTML&query=myelin%20sheath&it=xg&req=4 through an ion channel in frog muscle? The
&npos=100.
concentration of Na+ inside and outside of
a. Isomerization muscle cells is 10.4 mM and 109 mM,
b. Phosphorylation respectively; the temperature is 285 Kelvin; and
c. Condensation the Vm, or resting membrane potential, is −60
d. Reduction mV. The gas constant and Faraday constant are
8.31 joules/mol·K and 9.65 × 104 coulombs/
Use the following information to answer questions mol, respectively.
52 and 53. a. 4.9 ×106
b. 5.8 × 106
The following graph displays the results of a study of
c. 1.71 × 109
post-mortem brain tissue from individuals with
d. 3.22 × 1010
dementia with Lewy bodies (DLB), Alzheimer’s dis-
ease (AD), vascular dementia (VaD), and health con-
55. Which of the following changes results in
trols. Tissue sections were immunostained for
membrane repolarization following the action
degraded myelin basic protein (dMBP).
potential of a neuron?
a. Efflux of K+
b. Action of the ATP-dependent Na-K pump
Control
c. Influx of Cl− passively into the neuron
DLB d. Opening of Na+ channels
AD
VaD
56. Which of the following properties do the
endocrine system and neurons have in common?
a. They primarily transmit messages through
0 .2 .4 .6 .8 1 1.2 1.4 1.6
paracrine signaling.
%dMBP b. They transmit their signals (hormones and
neurotransmitters) primarily via the
52. Based on the graph, which disease is associated bloodstream.
with the most extensive myelin degeneration? c. They can transmit specific messages using
a. Dementia with Lewy bodies the same type of hormone or
b. Alzheimer’s neurotransmitter molecule.
c. Vascular dementia d. They respond to extracellular calcium
d. They are associated with similar amounts of through exocytosis.
myelin degeneration.
161
 –M C AT ® E X A M P R A C T I C E T E S T 2–

57. How are cortical and trabecular bones similar 2. A box of mass 500 kg is pulled on a wagon
to each other? across a level floor. A man pulls the wagon
a. They have similar rates of turnover. handle horizontally at a 50 degree angle by
b. They have the same type of microstructure. exerting a force of 240 N. The force of friction
c. They are made up of the same mineral is 100 N. What is the acceleration of the
components. wagon?
d. They are similarly affected by osteoporotic a. 10.8 cm/s2
fractures. b. 16.8 cm/s2
c. 50.8 cm/s2
58. Which of the following statements about the d. 56.8 cm/s2
digestive system is NOT true?
a. Digestion starts in the mouth. 3. The least-stable non-planar conformation for a
b. Muscle contractions called peristalsis move cyclic hexose carbohydrate is the
food through the esophagus and intestines. a. boat conformation.
c. Passing stool occurs when the sphincters b. chair conformation.
relax and the rectum contracts. c. half-chair conformation.
d. The main function of the liver is to detoxify d. twist-boat conformation.
chemicals that could be harmful.
4. The number of proton nuclear magnetic reso-
59. Which of the following pathways directs the nance (NMR) signals produced by 2-methyl-
differentiation of multipotent skin cells into fluorobenzene is
hair follicles? a. 1.
a. Hippo b. 3.
b. Notch c. 5.
c. Ras/Raf/MAP kinase d. 7.
d. Wnt/Wingless
5. A 1.0-kg sugar cube (C12H22O11) is dissolved in
400 mL of acetone (density = 0.791 g/mL).
Part 2: Chemical and Physical What is the molality of the sugar solution?
Foundations of a. 7.3 mol/L
Biological systems b. 7.3 mol/kg
c. 9.2 mol/L
95 Minutes d. 9.2 mol/kg
59 Questions

1. As an ambulance with a blaring siren

approaches, the pitch (frequency) of the sound
a. increases, per the Doppler effect.
b. decreases, per the Doppler effect.
c. increases, per the Venturi effect.
d. decreases, per the Venturi effect.

162
 –M C AT ® E X A M P R A C T I C E T E S T 2–

Use the following information to answer questions 6 through 9.

Cyclodextrins (CDs) are a group of naturally cyclic oligosaccharides consisting of six, seven, or eight glucose
subunits connected by a-(1,4) glycosidic bonds, named a-, b-, and γ-CDs, respectively. They are shaped cylin-
drically, with glycosidic oxygen bridges on the inside and hydroxyl groups on the outside. CDs can form inclu-
sion complexes with molecules whose moieties interact with their internal surfaces. A novel method was
developed for the preparation of b-CD functionalized magnetic nanoparticles (MNPs) (Figure 1).

Figure 1. The preparation of b-CD functionalized magnetic nanoparticles. After OA-coated MNP synthesis, monotosyl-
PEG silane was immobilized on them, and then toluene washes removed residual monotosyl-PEG silane and displaced
OA. The material was dried in a vacuum, and then the MNPs were dispersed into DMF.

163
 –M C AT ® E X A M P R A C T I C E T E S T 2–

Monotosyl-polyethylene glycol (PEG) silane was synthesized by the route shown in Figure 2, where a PEG diol
was modified to form the corresponding monotosyl-PEG, followed by reaction of the molecule with IPTS. 1H
NMR and FTIR spectroscopy were used to track molecule formation after each step, ultimately confirming
formation of monotosyl-PEG silane. The nanoparticles were modified with the monotosyl-PEG silane first,
and then amino-b-CD units displaced the tosyl units.

Figure 2. Preparation of monotosyl-PEG silane.

Y. Wu et al. A novel approach to molecular recognition surface of magnetic nanoparticles based on host-guest effect. Nanoscale Res
Lett. 2009;4:738–747.

6. Moieties that are most likely to interact with 8. The reason for the inclusion of tosyl groups in
CDs in inclusion complexes are the synthesis is to
a. positively charged. a. contribute an oxygen to the functionalized
b. negatively charged. final product.
c. hydrophobic. b. contribute a sulfur to the functionalized
d. amphipathic. product.
c. provide an effective leaving group for the
7. The first reaction step in Figure 2 can be ensuing nucleophilic attack.
completed by reacting PEG, tosyl chloride, and d. promote reactivity at the adjacent oxygen
a. a weak acid in an SN1 reaction. originally on the PEG diol.
b. a weak base in an SN1 reaction.
c. a weak acid in an SN2 reaction.
d. a weak base in an SN2 reaction.

164
 –M C AT ® E X A M P R A C T I C E T E S T 2–

9. Which intermediate or product in this synthesis does the FTIR spectrum below represent?
% Transmittance

1595.5

815.9
1535.0

1280.1
1710.6

1174.5
4,000 3,500 3,000 2,500 2,000 1,500 1,000 500
Wave Numbers (cm-1)

a. PEG diol
b. OA-MNPs
c. monotosyl-PEG silane
d. b-CD–PEG–MNPs

Use the following information to answer questions column. IDO1 activity was measured in the absence
10 through 14. and presence of various potential inhibitors in buffer
at pH 6.5. Galanal was found to inhibit IDO1
Indoleamine 2,3-dioxygenase (IDO) 1 catalyzes the activity, and based on the Michaelis-Menten kinetics
first and rate-limiting step of L-tryptophan of IDO1, its inhibitory mode was further studied by
degradation in the tryptophan-kynurenine pathway. measuring the initial rate of L-kynurenine
The direct product of IDO1 is N´-formylkynurenine, production in the presence and absence of 30 µM
which breaks down non-enzymatically to galanal at various L-tryptophan concentrations
L-kynurenine by losing its formyl group. (Figure 1).
His-tagged human IDO1 cDNA was expressed
in Escherichia coli and purified using a nickel

165
 –M C AT ® E X A M P R A C T I C E T E S T 2–

A 10. Based on the described enzymatic activity of

IDO1, what is the structure of L-kynurenine?
a.

b.

c.
B

d.

–
11. The mode of IDO1 protein purification
Figure 1. The effect of galanal on IDO1 activity. described in the passage is an example of
R. Yamamoto et al. Effects of various phytochemicals on indole-
amine 2,3-dioxygenase 1 activity: galanal is a novel, competitive a. size exclusion chromatography.
inhibitor of the enzyme. PLoS ONE. 2014;9(2):e88789. b. affinity chromatography.
c. anion exchange chromatography.
d. cation exchange chromatography.

166
 –M C AT ® E X A M P R A C T I C E T E S T 2–

12. The following table provides pKa values for 15% to 30% protein mass. The main lipid found in
four buffers at room temperature: myelin is galactocerebroside, which can also be
sulfated at carbon 3 on the galactose ring by
BuFFER pK a sulphotransferase (Figure 1). The primary function
Potassium phosphate 2.15, 7.20, 12.15 of the myelin sheath is to increase the speed at which
Potassium acetate 4.76
impulses propagate along the myelinated fiber,
decreasing capacitance and increasing electrical
Tris 8.08
resistance across the cell membrane. Impulses move
TEA 10.72
continuously as waves along unmyelinated fibers, but
Which buffer would be most appropriate for saltatory conduction occurs along myelinated fibers,
measuring IPO1 reactivity? with intracellular and extracellular fluid separated
strongly. The nodes of Ranvier, unlike the myelin
a. Potassium phosphate
sheath, contain many voltage-gated sodium channels
b. Potassium acetate
that allow enough sodium into the axon to create an
c. Tris
action potential. Diseases like multiple sclerosis and
d. TEA
Guillain-Barré disease are caused by the destruction
of the myelin sheath.
13. The graph used to study galanal inhibition of
IDO1 in Figure 1B is called a(n)
a. Eadie-Hofstee diagram.
b. Lineweaver-Burk plot.
c. Hanes-Woolf plot.
d. Hill plot.

14. The mode of IDO1 inhibition by galanal is Figure 1. The structure of galactocerebroside.
a. competitive.
b. uncompetitive. 15. The cells that produce the myelin sheath are
c. noncompetitive. called
d. irreversible covalent adduct formation. a. Schwann cells.
b. presynaptic cells.
Use the following information to answer questions c. postsynaptic cells.
15 through 19. d. Langerhans cells.

Myelin is an essential electrically insulating material 16. Based on the structure in Figure 1,
that forms a layer around the axon of a neuron. The galactocerebroside is best categorized as a
production of this myelin sheath is called a. sterol lipid.
myelination, and it begins in humans several months b. glycerolipid.
into fetal development. Although myelin is c. fatty acid.
approximately 40% water, its dry mass is d. sphingolipid.
approximately 70% to 85% lipid and approximately

167
 –M C AT ® E X A M P R A C T I C E T E S T 2–

17. Based on the structure of galactocerebroside, Use the following information to answer questions
the most stable configuration of the sulfated 20 through 23.
hydroxyl group in sulfated galactocerebroside
is A woman of mass 55 kg begins motionless atop a
a. axial. hill. She skis all the way down the frictionless hill,
b. equatorial. which is 90 m high, to height 0 m, and then she
c. either axial or equatorial because both are ascends another hill that is 75 m high. This skier is in
equally stable. a conservative system, with gravity as the only force
d. neither axial nor equatorial because the ring acting upon her.
is a benzene ring, not a cyclohexose.
START
18. The myelin sheath helps to reduce energy
expenditure over the overall axon membrane FINISH
because
a. it increases the permeability of the axon
surface for transfer of sodium and
potassium ions via diffusion, reducing the
need for an ATP-requiring pump.
b. it decreases the number of sodium and
potassium ions that need to be pumped to
restore resting state concentrations after
each action potential.
Figure 1. A diagram of the ski slopes.
c. the increased impulse speed reduces the
amount of work required for its propulsion
through the axon, reducing the amount of 20. In a conservative system like the one described
ATP needed to do so. in the passage, which of the following
d. it decreases the pressure of the axon to statements are true?
increase the speed of the impulse through I. The work done by a force is completely
the axon. reversible.
II. The work done by a force is dependent on
19. Based on its functional description in the the path taken.
passage, myelin can be classified as a III. The work done by a force is equal to the
a. semiconductor. difference between the final and initial values
b. cathode. of an energy function.
c. dielectric.
d. refrigerant. a. I only
b. I and II only
c. I and III only
d. I, II, and III

168
 –M C AT ® E X A M P R A C T I C E T E S T 2–

21. At what speed is the skier moving when she placed near the negatively charged substituents on
reaches the peak of the second hill? the dye. When protein binds the dye, the complex is
a. 12.1 m/s stabilized and exhibits an absorbance maximum at
b. 17.1 m/s 595 nm that is proportional to the amount of bound
c. 22.3 m/s dye.
d. 25.0 m/s Though the Bradford assay is less susceptible to
interference by other chemicals that might be present
22. How much of the skier’s original potential in the protein solution, the presence of the organic
energy is lost during her journey from the peak anionic detergent sodium dodecyl sulfate (SDS) can
of the first hill to the peak of the second hill? disrupt the Bradford assay, working by two different
a. 1.24 kJ modes at low and high concentrations to impact the
b. 2.45 kJ absorbance readings at 595 nm.
c. 5.76 kJ
O
d. 8.09 kJ +
H3C S–O–
N
O
23. At which point in her ski route will the skier
have the greatest amount of kinetic energy? CH3 H3C CH3
a. At the top of the first hill
O
b. Halfway down the first hill O
c. At a height of 0 m between the hills N N S–ONa
d. Halfway up the second hill H O
H3C

Use the following information to answer questions Figure 1. The structure of Coomassie Brilliant Blue G-250
24 through 31. dye in its green form.

The Bradford assay is a common analytical technique 24. Which amino acid might accept a proton from
that is used to measure the concentration of protein the dye?
in a solution. It is both a spectroscopic and a. Arginine
colorimetric procedure that is based on the b. Glutamic acid
absorbance shift of the Coomassie Brilliant Blue c. Cysteine
G-250 dye (Figure 1). The dye exists in the three d. Glutamine
forms: cationic (red), neutral (green), and anionic
(blue). Under the acidic conditions used to perform
the assay, the red form of the dye binds the protein
and is converted to a stable blue anionic form,
disrupting the native state of the protein and
exposing its hydrophobic pockets. The hydrophobic
regions of the protein bind to the nonpolar region of
the dye, and the amine groups of the protein are

169
 –M C AT ® E X A M P R A C T I C E T E S T 2–

25. According to the passage, the intermolecular absorptivity of a particular protein, it is abso-
forces that are most essential for stabilizing the lutely essential that
complex between the dye and the unfolded a. all cofactors have been removed from the
protein are protein.
b. the protein is in its correct polymeric form.
I. hydrogen bonds c. the protein is extremely pure.
II. van der Waals forces d. there are tryptophan residues in the protein.
III. ionic forces

a. I and II only 28. Why might SDS be present in a purified

b. I and III only protein solution immediately following a
c. II and III only standard purification procedure?
d. I, II, and III a. SDS is commonly used to support cellular
growth in growth media.
26. The absorbance of a newly discovered protein b. SDS is used for protein separation in
at 595 nm is determined, normalized with the SDS-PAGE.
appropriate baseline spectrum. If the protein c. SDS is commonly used to lyse cells by
concentration is to be directly calculated from disrupting the membrane lipid bilayer.
this absorbance, what additional information is d. Most methods of column chromatography
needed? require the use of SDS for resin stabilization.
a. The molecular weight of the protein,
determined via size-exclusion 29. How might SDS interact with the dye to
chromatography using a set of molecular disrupt the Bradford assay?
weight standards a. SDS associates strongly with the red and
b. The dissociation constant for the binding of green forms of the dye, increasing the
the dye to the protein of interest absorbance at 595 nm independently of
c. The spectrum for the red form of the dye for protein presence.
A595 correction b. SDS associates strongly with the red and
d. The equation of the standard curve line green forms of the dye, decreasing the
relating A595 and a series of known absorbance at 595 nm independently of
concentrations of a standard protein protein presence.
c. SDS associates strongly with the blue form
27. The Beer-Lambert law relates light absorption of the dye, increasing the absorbance at 595
to the properties of the material of interest nm independently of protein presence.
through the equation A = bc, where A is d. SDS associates strongly with the blue form
absorbance in the Bradford assay, is the molar of the dye, decreasing the absorbance at 595
absorptivity (L mol–1 cm–1) of the material, b is nm independently of protein presence.
the path length of the cuvette containing the
sample in the spectrometer, and c is the
concentration (mol/L) of the material in
solution. If one wishes to determine the molar

170
 –M C AT ® E X A M P R A C T I C E T E S T 2–

30. How might SDS interact with the protein to 33. Xylem is a transport tissue found in vascular
disrupt the Bradford assay? plants that transports water and nutrients. A
a. SDS binds to the protein, blocking protein xylem tube pushes xylem sap upward through
binding sites for the dye and causing the plant via capillary action. Which of the fol-
overestimation of the protein concentration. lowing principles is NOT responsible for this
b. SDS binds to the protein, blocking protein phenomenon?
binding sites for the dye and causing a. Surface tension
underestimation of the protein b. Buoyancy
concentration. c. Cohesion
c. SDS binds to the protein, enhancing protein- d. Adhesion
dye interactions and causing overestimation
of the protein concentration. 34. A proton travels at 7.5 × 107 m/s perpendicu-
d. SDS binds to the protein, enhancing protein- larly to a magnetic field that causes it to move
dye interactions and causing in a circular path with a 1.00 m radius. The
underestimation of the protein mass of a proton is 1.67 × 10–27 kg, and the
concentration. charge of a proton is 1.60 × 10–19 c. What is the
strength of the magnetic field?
31. The passage provides the wavelength of a. 0.139 T
maximum absorbance for the blue form of the b. 0.783 T
dye. Based on the electromagnetic spectrum c. 1.28 T
and principles of light absorption, the d. 7.19 T
wavelengths of maximum absorbance for the
red and green forms, respectively, are 35. Lead chloride dissolves, to a limited extent, in
a. 250 nm and 470 nm. water by the following equilibrium expression:
b. 470 nm and 250 nm. –
PbCl2(s) Pb2+(aq) + 2Cl (aq)
c. 470 nm and 650 nm.
d. 650 nm and 470 nm. How does the addition of NaCl to the solution
affect PbCl2 solubility and the Ksp?
32. A round hole with a diameter of 10 cm is cut
a. PbCl2 solubility increases and Ksp decreases.
into a sheet of brass. The coefficient of linear
b. PbCl2 solubility increases and Ksp stays the
thermal expansion (a) is 18.9 × 10–6 ÷ °C.
same.
What will be the change in area of the hole
c. PbCl2 solubility decreases and Ksp decreases.
when the temperature is increased by 50°C?
d. PbCl2 solubility decreases and Ksp stays the
a. 0.00 cm2
same.
b. 7.40 × 10–2 cm2
c. 0.148 cm2
d. 0.594 cm2

171
 –M C AT ® E X A M P R A C T I C E T E S T 2–

36. In Ernest Rutherford’s famous gold foil 39. Purified ATPase was incubated with 200 µM
experiment, Rutherford studied the angles of dicyclohexylcarbodiimide (DCCD) at pH 7.6
radiation particle scattering as the particles (A) and 9.0 (B). Individual mixtures contained
passed through a thin sheet of gold foil. Most no NaCl (open circles), 1 mM NaCl (closed
particles passed through without deflection, triangles), 10 mM NaCl (open triangles), and
but a few particles were deflected at various 50 mM NaCl (closed squares). ATPase
angles. The scattering was attributed to reactivity was initiated by 4 mM ATP, and the
repulsion of the particles by the atomic nuclei residual ATPase activity of the samples was
in the foil. The type of radiation particles measured at various times. The graph with the
Rutherford used, therefore, were closed circles is the control with no DCCD.
a. neutrons. A
100
b. a particles.
c. b particles.

Residual ATPase activity (%)

d. γ particles. 80

37. The fourth ionization energy of aluminum is 60

immensely higher than the first three
ionization energies because 40
a. a significant amount of energy is needed to
remove an electron from the filled-shell 20
configuration of the Al3+ ion.
b. the force of repulsion between the electron
0
being added and the electrons already 0 5 10 15 20
present is significantly higher. Time (min)
B
c. the first three ionization energies do not 100
require electron excitation, but this
requirement greatly increases the fourth
Residual ATPase activity (%)

80
ionization energy.
d. the mass of the Al3+ ion increases
60
significantly during this transition, and
energy is inversely proportional to mass.
40

38. A 250-g calorimeter with a specific heat capacity

of 20.0 J/g · °C contains 600 g of water (c = 4.18 20
J/g · °C). Given that the molar heat of combus-
tion of sucrose, C12H22O11, releases 5.65 × 103 kJ 0
0 5 10 15 20
of heat, what mass of sucrose must be burned to
Time (min)
increase the temperature of the water and calo-
rimeter by 10°C? Image from A. Soontharapirakkul and K. Incharoensakdi.
a. 1.52 g Na+-stimulated ATPase of alkaliphilic halo-tolerant cyanobacte-
rium Aphanothece halophytica translocates Na+ into proteolipo-
b. 3.03 g somes via Na+ uniport mechanism. BMC Biochemistry.
c. 4.55 g 2010;11:30.

d. 7.90 g

172
 –M C AT ® E X A M P R A C T I C E T E S T 2–

Which of the conclusions about the role of Na+ 41. When ice is placed in a vessel and heated at
in the activity of this ATPase is valid based on 55°C, it melts. Which of the following
the collected data? statements are true?
a. Na+ effectively inhibits ATPase activity, but I. The change in free energy is positive.
its inhibition is weakened in the presence of II. The change in entropy is positive.
DCCD. III. The change in enthalpy is positive.
b. Increasing concentration of Na+ effectively a. I and II only
protects against DCCD inhibition of the b. I and III only
ATPase. c. II and III only
c. Na+ and DCCD work together in a d. I, II, and III
cooperative fashion to inhibit the activity of
this ATPase. 42. The van der Waals equation modifies the ideal
d. Na+ and DCCD work together in a gas law to account for deviations of real gases
cooperative fashion to stimulate the activity from ideal gas behavior. The two factors the
of this ATPase. equation takes into consideration are
a. phase changes and chemical bonding.
40. According to Faraday’s laws of electrolysis, the b. molecular expansion and chemical
masses of substances formed during transformations.
electrolysis at an electrode are c. molecular volume and molecular
a. directly proportional to the quantity of attractions.
electricity that passes through the electrolyte. d. molecular masses and partial pressures.
b. inversely proportional to the quantity of
electricity that passes through the electrolyte.
c. directly proportional to the capacitance of
the system.
d. inversely proportional to the capacitance of
the system.

Use the following information to answer questions 43 through 46.

A scientist accidentally mixed together concentrated pure samples of four well-characterized human proteins.
The proteins were diluted into buffer of pH 6.0. The following table provides general data about the four
proteins:

PRoTEIN MoLECuLAR WEIGHT (kda) pI FuNCTIoN

Calmodulin I 16.7 3.9 Binds Ca2+ and transduces calcium signals
Phosphorylates glucose to glucose-6-phosphate
Glucokinase 50.9 5.0
using ATP
Hemoglobin 16.0 6.9 Binds and transports oxygen
Transferrin (diferric) 80.0 5.2 Binds and transports iron

173
 –M C AT ® E X A M P R A C T I C E T E S T 2–

The scientist first separated the proteins based on 45. When the solution of calmodulin I and
molecular weight, which allowed for the isolation of hemoglobin is separated during the second
glucokinase and transferrin because their molecular purification step, which protein(s) will bind
weights were distinct. The buffer was exchanged in the resin?
the solution containing the other two proteins, a. Hemoglobin only
replacing the pH 6.0 buffer with pH 5.0 buffer. The b. Calmodulin I only
scientist then used the difference in pI to separate c. Both hemoglobin and calmodulin I
calmodulin I and hemoglobin by anion exchange d. Neither hemoglobin nor calmodulin I
chromatography, as the molecular weights of these
proteins were too close to separate by the previous 46. The observed Soret peak in the hemoglobin
method without time-consuming optimization. UV-visible spectrum, as described in the
After obtaining pure samples of the four passage, is caused by
proteins through this purification strategy, the a. a-helices in the active site pocket.
scientist added appropriate cofactors to the proteins, b. b-sheets in the active site pocket.
took UV-visible spectra of each protein, and then c. the tryptophan residues in the protein.
tested the binding of several molecules to each d. the π electrons in the bound porphyrin ring.
protein in order to confirm the appropriate identities
of the four proteins. The UV-visible spectrum of Use the following information to answer questions
hemoglobin notably included a large Soret peak 47 through 51.
around 412 nm, and this sample was successfully able
to bind oxygen. The reaction of gaseous carbon dioxide and steam
results in the formation of oxygen gas and acetylene
43. A possible method by which the scientist could gas. A balanced equation for this reaction is shown
have isolated glucokinase and transferrin below:
during the protocol described in the passage is
a. paper chromatography. 4CO2(g) + 2H2O(g) → 2C2H2(g) + 5O2(g)
b. SDS-PAGE. ∆H values are provided for a series of related
c. distillation. reactions:
d. gel filtration chromatography.
C2H2(g) + 2H2(g) → C2H6(g) ∆H = –94.5 kJ
44. Which technique would be suitable to use for 1
H2O(g) → H2(g) + __ ∆H = –71.2 kJ
2 O2(g)
buffer exchange between the two separation 7
methods, as described in the passage? 2 O2(g) → 2CO2(g) + 3H2O(g)
C2H6(g) + __
a. Dialysis ∆H = –283 kJ
b. Affinity chromatography
c. High-pressure liquid chromatography 47. What is the value of ∆H for the overall reaction
d. Extraction of carbon dioxide with steam?
a. –306 kJ
b. +235 kJ
c. +306 kJ
d. +470 kJ

174
 –M C AT ® E X A M P R A C T I C E T E S T 2–

48. If 2.0 g each of CO2(g) and H2O(g) react Use the following information to answer questions
completely, what mass of C2H2 will be 52 through 55.
produced?
Nickel (II) oxide (NiO) is often deposited as a thin
a. 0.59 g
film onto glass substrates through spray pyrolysis. The
b. 1.2 g
electrical properties of the NiO film were
c. 2.4 g
characterized experimentally. The electrical resistivity
d. 2.9 g
was recorded within the approximate 30°C to 170°C
range (Figure 1). In addition, the activation energy of
49. The value of ∆S for the reaction of CO2(g) and
conductivity was determined by plotting the natural
H2O(g) is
log of the DC conductivity as a function of 1000/T
a. positive because a greater number of moles
(Figure 2). The NiO film was also, importantly,
of CO2 than H2O are required for the
characterized structurally using X-ray diffraction.
reaction.
a. negative because a greater number of moles 800
of CO2 than H2O are required for the 700

reaction. ρ (Ω·cm)
600

c. positive because the number of gas 500

400
molecules increases over the course of the
300
reaction.
200
d. negative because the number of gas 100
molecules increases over the course of the 0
250 300 350 400 450 500
reaction.
T (K)

50. When CO2(g) and H2O(g) react, the two Figure 1. Resistivity as a function of temperature for NiO
films.
gaseous products are collected in separate
containers. If 5.00 g CO2 reacts with an excess 1,000/T(K)–1
of H2O, what volume of O2 will be produced at 0
2.2 2.4 2.6 2.8 3 3.2 3.4
STP (standard temperature and pressure), –1

given that the ideal gas constant, R, is equal –2

Lnσ (Ω·cm)–1

L atm
mol K –3
to 0.08206 ?
–4
a. 0.373 L
–5
b. 1.27 L
–6
c. 2.55 L
–7
d. 3.18 L T (K)

51. The VSEPR shape of CO2(g) is Figure 2. Activation energy for NiO films.
A. Hassan. Study of optical and electrical properties of nickel
a. bent. oxide (NiO) thin films deposited by using a spray pyrolysis tech-
b. tetrahedral. nique. J Modern Phys. 2014;5:2184–2191.
c. T-shaped.
d. linear.

175
 –M C AT ® E X A M P R A C T I C E T E S T 2–

52. The key difference between resistance and Use the following information to answer questions
resistivity is that 56 through 59.
a. resistance is a state function, whereas
resistivity is not. The structure of adenosine triphosphate (ATP) is
b. resistance is dependent on sample shown below (Figure 1). ATP is hydrolyzed to ADP
dimensions, whereas resistivity is not. and inorganic phosphate when in equilibrium with
c. resistivity is temperature dependent, whereas water, and the high energy of this molecule comes
resistance is not. from two high-energy phosphoanhydride bonds.
d. resistance is the product of the Boltzmann Each bond has a ∆G of −30.5 kJ/mol. Therefore, the
constant and the resistivity. free energy released by hydrolysis of ATP to ADP and
inorganic phosphate under standard conditions,
53. The structural characterization technique ∆G°´, is equal to −30.5 kJ/mol at pH 7.0.
described in the passage provides information
about
a. the susceptibility of the NiO film to
oxidation or reduction.
b. the NiO film’s crystalline phase and unit cell
dimensions.
c. the presence of excited electrons in the NiO
film.
d. the Ni-O bond lengths and bond angles.
Figure 1. The structure of ATP.

54. The electrical data collected in Figures 1 and 2

support the conclusion that 56. The nucleoside component of ATP is a
a. NiO films are conductors. a. porphyrin.
b. NiO films are magnets. b. purine.
c. NiO films are insulators. c. pyrimidine.
d. NiO films are semiconductors. d. flavin.

55. The activation energy can be determined using 57. The value for ∆G°´ indicates that ATP
the data in Figure 2 by multiplying the hydrolysis is
Boltzmann constant by a. exothermic.
a. the slope of each line, at high and low b. endothermic.
temperatures. c. exergonic.
b. the y-intercept of each line, at high and low d. endergonic.
temperatures.
c. the x-intercept of each line, at high and low
temperatures.
d. the sum of the y-intercept and the
x-intercept of each line, at high and low
temperatures.

176
 –M C AT ® E X A M P R A C T I C E T E S T 2–

58. The following table provides the concentra- Part 3: Psychological, social,
tions of ATP, ADP, and Pi in human and Biological Foundations
erythrocytes: of Behavior
CoNCENTRATIoN IN HuMAN
MoLECuLE ERyTHRoCyTEs (mM)
ATP 2.24 59 Questions
95 Minutes
ADP 0.25
Pi 1.65
Use the following images to answer questions 1
Given that the constant R is equal to through 5.
kJ
mol K
0.08314 , and assuming equilibrium at pH Central sulcus
7.0 and body temperature of 37°C, what is the
free energy of hydrolysis of ATP under these Parieto-occipital
sulcus
conditions?

a. –52 kJ/mol
b. –41 kJ/mol
Frontal
c. –33 kJ/mol Occipital pole
pole Lateral fissure
d. –8.5 kJ/mol Preoccipital
notch Temporal
pole
59. The observed ∆G°´ for ATP hydrolysis to ADP
and inorganic phosphate CANNOT be Human brain, image 1.
http://en.wikipedia.org/wiki/Central_sulcus#/media/
attributed to File:LobesCaptsLateral.png.
a. electrostatic repulsions among the negative
oxygen atoms in ATP.
b. greater resonance stabilization of ADP
relative to ATP.
c. lower solvation of inorganic phosphate, H+,
and ADP relative to ATP. Caudate nucleus

d. higher disorder and lower free energy in

ADP relative to ATP.

LEFT RIGHT

Human brain, image 2.

http://pixabay.com/en/brain-diagram-medical-biology-40356/.

177
 –M C AT ® E X A M P R A C T I C E T E S T 2–

1. A man becomes very angry with his neighbor 5. Brain damage in which lobe of the brain would
for taking his parking spot. Which part of the MOST affect higher-level cognition?
brain evokes this emotion? a. Frontal
a. Occipital pole b. Occipital
b. Amygdala c. Parietal
c. Cerebellum d. Temporal
d. Fornix
Use the following passage to answer questions 6
2. Typically, people cope with stress with either through 10.
emotion-focused or problem-focused
strategies. If the man utilizes a problem- A graduate student is interested in changing her
focused coping strategy, he could do any of the teaching from a traditional method to one that
following EXCEPT includes significantly more discourse with her
a. approach the neighbor to see if there is a students. She is a teaching assistant for a first-
misunderstanding. semester biology course at the same university where
b. speak with the apartment complex she is pursuing her master’s level secondary
management about a possible alternate (teaching) biology certification and degree. A study
parking spot. researcher is interested in documenting the graduate
c. write a letter to the apartment association student’s experience as she attempts to implement
about the need for strict parking guidelines. this new method.
d. vent to other people about the problem. The researcher videotapes the graduate student
each week as she is teaching her class; the graduate
3. Which lobe of the brain receives and processes student views the tape later while being interviewed
sensory information from the body? about what happened both in the class and outside
a. Frontal of the class. Surprisingly, the individuals who
b. Occipital experience the most cognitive dissonance about the
c. Parietal teaching methodology are not the students or the
d. Temporal graduate student, but rather the graduate student’s
supervisors in the biology department. The new
4. What do olfactory pathways do in the brain? teaching method is the first of its kind, and limited
a. Carry the sense of smell from the nose to the success was expected. The student teacher decides to
brain to be processed continue the new teaching method regardless of her
b. Carry visual images from the eyes to the supervisors’ opinions. When the findings suggest the
brain to be processed methodology to be beneficial, the supervisors have a
c. Carry the tastes of food from the tongue to change of mind and support the new methodology.
the brain to be processed
d. Carry sounds from the ears to the brain to
be processed

178
 –M C AT ® E X A M P R A C T I C E T E S T 2–

6. Which of the following is the BEST example of 9. The graduate student’s decision to continue
what cognitive dissonance may have looked implementing the new method instead of
like in this research study? reverting to the more familiar, traditional
a. The supervisors were confused and method despite her supervisors’ cognitive
disapproved of the teaching method because dissonance means she probably had a high
it was different from how college biology is level of
usually taught. a. self-fulfilling prophecy.
b. The supervisors were pleased that the b. stereotype threat.
student teacher was trying an innovative c. self-efficacy.
teaching method and planned to implement d. stigma.
it with other teachers.
c. The supervisors received a lot of complaints 10. The supervisors were likely comparing the
from the students in the class and graduate student to which group?
disciplined the student teacher for her new a. Class identity group
teaching method. b. Self-identity group
d. The supervisors were initially happy with c. Power group
the new teaching method but grew tired of d. Reference group
hearing complaints from other student
teachers by the end of the study. 11. An Internet phenomenon in 2015 featured a
picture of a dress that different people saw as
7. Which type of research methodology was different colors. Some saw it as blue and black,
performed in this study? while others saw it as white and gold. Which of
a. Case study the following is the BEST term for the process
b. Experimental responsible for people forming different color
c. Split-half perceptions?
d. Item equating a. Somatosensation
b. Optic nerve malfunction
8. What is the MOST likely expectation of the c. Parallel processing
supervisors of the graduate student in this d. Auditory processing
study?
a. Peer pressure 12. The “fight or flight” experience is centered in
b. Conformity which system in the body?
c. Role playing a. Endocrine
d. Social loafing b. Lymphatic
c. Integumentary
d. Cardiovascular

179
 –M C AT ® E X A M P R A C T I C E T E S T 2–

13. According to sociocognitive theory, the c. Environmental issues like global warming do
development of prejudice in self-identity not really exist and are just part of the liberal
begins at a young age. For example, small agenda.
children are likely to believe that girls are not d. Environmental issues historically have been
good at sports and that boys get into trouble less important to minority groups than
more often. At what age is this likely to start to more pressing socioeconomic issues.
turn around to a more positive viewpoint?
a. 4 to 6 years old Use the following passage to answer questions 16
b. 5 to 7 years old through 20.
c. 8 to 9 years old
d. 10 to 11 years old Symbolic interactionism is a sociology theory based
on ways of understanding the workings of the world
14. Typically, what is the MAIN difference between in relation to oneself. It emphasizes the language and
how Eastern and Western cultures value aging? symbols that give meaning to how people see
a. Eastern cultures tend to provide financial themselves, the world, and the relationships between
incentives to the elderly, whereas Western them. As people interact with the world, they often
cultures do not. change the way they behave based on how they
b. Aging in Eastern cultures is socially define those interactions. They spend time thinking
constructed, whereas aging in Western about what to do next depending on how they
cultures is personally constructed. believe others view them.
c. Eastern cultures tend to value age and Social interactionists believe that
wisdom, whereas Western cultures tend to communications and interactions form the reality
value youth. each individual identifies with. People create these
d. Some Eastern cultures consider putting an realities based on external interactions and
elderly family member in a nursing home to perceptions; thus, each person’s reality is unique.
be an acceptable way to deal with Reality, according to this belief, is socially
overpopulation, whereas in the West, it is constructed, or created by thoughts, conversations,
usually done for health reasons. and ideas. Individuals both create and shape society,
and the change occurring is constant and ongoing.
15. Environmental justice advocates frequently Social interactionists are interested in the patterns
make the argument that minority populations created by people’s interactions and how an
disproportionally undertake or are subjected to individual’s reality shapes his or her daily existence.
environmentally hazardous activities because To better understand how social interactionists
they have few economic alternatives and/or are view the world, let’s consider a specific example.
not fully aware of the risks involved. Which of Imagine two men who have worked in the same
the following is the STRONGEST statement a department of the same company for many years.
person questioning this kind of environmental They have been rivals, both at times attempting to
racism might make? score a big promotion. One of the men (Colleague A)
a. Minority populations don’t care about is resentful of the other (Colleague B) because he
environmental issues. perceives Colleague B as pointing out his weaknesses
b. Environmental advocacy groups want to put in front of colleagues and making jokes about him
big businesses out of business. when all of the employees are out for happy-hour

180
 –M C AT ® E X A M P R A C T I C E T E S T 2–

drinks. Through such interactions, Colleague A 17. The example of the relationship between
develops a negative viewpoint of Colleague B. Events Colleague A and Colleague B falls within which
will also be symbolic to Colleague A, and the man of the following theories?
subjectively misperceives them. For instance, a. Social cognitive theory
Colleague B gets married and receives the promotion b. Vygotskyian theory
they had both been trying to acquire. He perceives c. Social conflict theory
Colleague B’s good fortune as a fact that he always d. Rational choice theory
gets what he wants and that all the good things
happen to him. However, later in the year, Colleague 18. Which of the following concepts BEST
B is fired and comes to Colleague A for support. describes the relationship between the two
Colleague A then feels needed and is able to be colleagues?
helpful to Colleague B. He no longer sees Colleague a. Deviance
B as a threat but rather as a friend. b. Collective behavior
Symbolic interactionists would look at the c. Agent of socialization
example above and note how one man’s view of the d. Social norms
other shaped his reality of the situation. Before his
colleague lost his job, Colleague A held one version 19. The evolution of Colleague A’s emotions
of reality in his mind. He symbolically saw his during the passage is MOST likely due to
colleague as having an unfair advantage in the world. which of the following?
When the dynamic shifted and the man played a role a. The adaptive role of emotion
of support to his colleague, the meaning he gave to b. Universal emotions
his relationship with him changed. All of this is based c. Child versus adult emotions
on the social interactions that occur, the language d. Brain development
used to communicate, and the symbolic meaning
given to these events and thoughts. 20. Which part of the brain is MOST involved in
the emotions the colleagues are experiencing in
16. The passage states that “reality, according to the passage?
this belief, is socially constructed, or created by a. The cerebellum
thoughts, conversations, and ideas.” Which of b. The cerebral cortex
the following technologies would MOST c. The brain stem
directly contribute to the social construction of d. The limbic system
reality?
a. Television Use the following passage to answer questions 21
b. Facebook or other social media through 26.
c. Satellite radio
d. A computer server Adult students’ ideas about scientific phenomena are
strongly held and resistant to change. In the 1980s, a
group of science educators came up with a theory of
“conceptual change” to explain how these resistant
scientific concepts could be changed via science
instruction. They called this process accommodation,

181
 –M C AT ® E X A M P R A C T I C E T E S T 2–

based on an earlier theory of “equilibration.” The 23. A team of science education researchers
reason scientific conceptions are so resistant to developed an instructional model based on the
change is that when new science content is learned, theory presented in the passage. They wanted
the learner’s brain changes the new content to fit to test its effectiveness, so they trained one high
what the learner already knows and believes about school physical science teacher on how to use
science content. However, the science educators the instructional model and selected another
proposed a four-part process as a model for physical science teacher from the same school
instructors to use to change existing misconceptions who was considered “exemplary” but did not
held by the learners. This process includes making use the conceptual change knowledge. The two
concepts intelligible, meaning they make sense to the teachers taught a unit on electricity. The
learners. They must also be made plausible to the students were pre- and post-tested on their
learner, meaning the new concepts are believable. knowledge of the unit content. Which of the
They must also be fruitful, meaning that the new following is the dependent variable in this
concepts can be used to understand future study?
phenomena they experience, as well as future science a. The students who received the conceptual
concepts. And, finally, they must be dissatisfied with change instruction
their existing misconceptions. The authors, however, b. The type of instruction provided to each of
stated that these are conditions for learning and that the two groups of students
it is a piecemeal and gradual process. They stated c. The difference in students’ scores between
that all four conditions must be present for a the pre- and post-tests
misconception to be changed. Science educators d. The teacher who did NOT provide the
since then have used the theory to create and test conceptual change instruction
new instructional models based on the four
conditions for conceptual change. 24. When learners are put through a process of
having their misconceptions challenged, they
21. The concepts of accommodation and frequently experience negative emotions, such
equilibration were first developed by which as anger and frustration. According to the
researcher(s)? conceptual change model, this is a necessary
a. James-Lange component of the model. Which theory BEST
b. Maslow supports this process?
c. Piaget a. Cognitive dissonance theory
d. Vygotsky b. Negative feedback systems
c. Behaviorist theory
22. When the brain changes new knowledge to fit d. Biopsychosocial approach
existing knowledge, what is this process called?
a. Accommodation 25. Which agent of socialization is MOST
b. Assimilation responsible for the resistance to change
c. Equilibration scientific misconceptions?
d. Stage progression a. The family
b. The media
c. The student’s peers
d. The educational system

182
 –M C AT ® E X A M P R A C T I C E T E S T 2–

26. Which of the following parts of the conceptual 30. All of the following are examples of social
change model is MOST likely to effect attitude institutions EXCEPT
change? a. marriage.
a. Intelligibility b. education.
b. Plausibility c. the Internet.
c. Fruitfulness d. government.
d. Dissatisfaction
Use the following passage to answer questions 31
27. Which of the following is an example of through 33.
bottom-up processing?
a. Understanding a paragraph with difficult Protein misfolding and subsequent aggregation have
handwriting by using context been proven to be the leading cause of most known
b. Understanding a situation using past dementias. Many dementias, in addition to
experiences neurodegeneration, show profound changes in
c. Identifying details of a stimulus using behavior and thinking, i.e., psychiatric symptoms.
perceptional signals On the basis of the observation that progressive
d. Understanding that a visual illusion is myoclonic epilepsies and neurodegenerative diseases
difficult using contextual clues share some common features of neurodegeneration,
autophagy may be a common impairment in these
28. Breast development in boys during adolescence diseases. A similar line could be argued for some
is typically unwanted in Western cultures. neuropsychiatric conditions, among them depression
What causes unwanted breast development to and schizophrenia. Existing and new therapies for
occur? these seemingly different diseases could be
a. It is a response to rising estradiol levels. augmented with drugs used for neurodegenera-
b. It is a response to increased testosterone tive or neuropsychiatric diseases, respectively, some
compared to estradiol. of which modulate or augment autophagy.
c. It is caused by menarche.
d. It is caused by increased myelinization in 31. The passage states that “autophagy may be a
males compared to females. common impairment in these diseases.” Given
that autophagy is a normal cell function, what
29. Which of the following is the BEST example of might be the impairment in autophagy that
a fundamental attribution error? causes diseases such as depression and
a. Someone trips on a dog and the observer schizophrenia?
assumes he did not see the dog, which in fact a. Cell destruction is not occurring as fast as it
was the case. is supposed to in neuron cells.
b. Someone trips on a dog and the observer b. Cell destruction in neurons is accelerated.
assumes he does not like the dog, when in c. Cell destruction occurs abruptly.
fact he did not see the dog. d. Cell destruction stops altogether.
c. Someone trips on a dog and assumes it is
because he can never do anything right.
d. Someone trips on a dog, and it is a self-
fulfilling prophecy.

183
 –M C AT ® E X A M P R A C T I C E T E S T 2–

32. Which of the following is MOST likely to occur 34. The passage refers to the generational
when autophagy is impaired? replacement of workers, thus the importance
a. Decrease in mania symptoms of women being able to bear children. This
b. Improvement in Parkinson’s disease description refers to which of the following
symptoms sociological principles?
c. Increase in behaviors associated with a. Intersectionality
personality disorders b. Class consciousness
d. Decrease in methamphetamine use c. Social reproduction
d. Intergenerational mobility
33. A study was performed to see whether new
therapies for these seemingly different diseases 35. What is the difference between the status of
could be augmented with drugs used for women in privileged classes and in oppressed
neurodegenerative or neuropsychiatric classes?
diseases. Which of the following would be the a. Privileged status is based on inheritance of
control group in the study? property; oppressed status is based on
a. The group that did not receive the new reproducing new workers.
therapy. b. Privileged status is based on inheritance of
b. The group that did receive the therapy. property; oppressed status is based on
c. The drug that had the best results in the maintenance of the property of the
study. privileged women.
d. The researchers performing the study. c. Privileged women are not oppressed.
d. The status of both types of women is related
Use the following passage to answer questions 34 to their ability to reproduce new class
through 38. members.

Class struggle is the key component of Marxist 36. What happens to the infant and maternal
theory. The dominant classes in exploitive societies mortality rates in oppressed classes?
take possession of surplus labor. Therefore, the a. They are the same as in the privileged class.
subordinate class is critical to production. To b. They are both higher than in the privileged
maintain surplus and prevent attrition, new workers class.
in such societies often come from generational c. The infant rate is higher but the maternal
replacement. This is why women’s capacity to have rate is the same as in the privileged class.
children plays an important role in class society, but d. The maternal rate is higher but the infant
also creates a different type of female oppression rate is the same as in the privileged class.
than occurs in the dominant class. Oppression of
women in the dominant classes originates from their 37. Based on the passage and what you know,
role in the maintenance and inheritance of property. which of the following MOST contributes to
In the subordinate classes, the female oppression infant mortality?
originates from the women’s involvement in the a. Lack of access to health care
processes that replenish workers, as well as their own b. The illness experience
work in production. c. Medicalization
d. The sick role

184
 –M C AT ® E X A M P R A C T I C E T E S T 2–

38. “The dominant classes in exploitive societies Use the following passage to answer questions 42
take possession of surplus labor. Therefore, the through 47.
subordinate class is critical to production.”
Which of the following labels BEST applies to Recent research has demonstrated that mentally
this quote from the passage? simulating positive intergroup encounters can
a. Aggression between groups promote tolerance and more positive intergroup
b. In-group versus out-group attitudes. A recent study explored the attributional
c. Prejudice process behind the positive effects. Participants were
d. Discrimination randomly assigned to three groups. In the first group,
participants were instructed to imagine intergroup
39. A group of researchers wants to know the effect contact from a first-person perspective. The second
of a particular treatment on using modeling to group was instructed to imagine the contact from a
change behavior. The results are promising. third-person perspective. Finally, the third group was
What is the next step in the research process? the control group and received no instructions.
a. Move on to the next problem. Participants from the first-person-perspective group
b. Switch the control and experimental groups indicated stronger intents to engage in future
and repeat the experiment. contact, but the intent was not significantly different
c. Double the size of the control group and from the intent of the control group. Despite this,
repeat the experiment. they did have more positive attitudinal orientation
d. Keep all variables the same and repeat the toward out-group encounters after the mental
experiment with a new set of participants. simulation. Participants in the third-person-
perspective group also reported stronger intents to
40. Which of the following identity formation engage in future contact, and those intents were
theories BEST describes that a person’s self- significantly stronger than the control group. The
identity grows out of interpersonal interactions findings suggest that attributional processes are
and the perceptions of others? important in observing the benefits that are attained
a. Looking-glass self from mentally simulating intergroup contact.
b. Role taking
c. Imitation 42. In this passage, how is attribution theory used?
d. Reference group a. External attribution
b. Interpersonal attribution
41. Which of the following theories focuses on c. Common sense attribution
how individuals learn to become criminals but d. Correspondent inference attribution
does not concern itself with why they become
43. The use of the methodology in the passage in
criminals?
future situations might lead to the reduction of
a. Strain theory
which of the following?
b. Differential association
a. Prejudice
c. Collective behavior
b. Self-efficacy
d. Labeling theory
c. Third-person perspective
d. Cognition

185
 –M C AT ® E X A M P R A C T I C E T E S T 2–

44. In this study, the first-person perspective and Use the following passage to answer questions 48
the third-person perspective were part of through 53.
which of the following?
a. Control group Many people believe mental illness cannot happen to
b. Experimental group them. However, one in five adults in America
c. Dependent variables experiences symptoms of a mental health condition
d. Independent variables each year. Although mental illness affects people in
all walks of life, culture plays an important role in its
45. What would be the name of the experimental impact. Many minority groups do not receive
group in sociological terms? adequate mental health treatment. This is often due
a. Primary group to labeling. Individuals from some racial and ethnic
b. Secondary group communities who display mental health deficits
c. Out-group often experience a more serious disease course than
d. Triad the general population and often receive
misdiagnoses.
46. Which type of strategy is occurring in this Another problem for minority groups is the
study? lack of access to quality services. Lack of mental
a. Classical conditioning health insurance and inability to pay for prescription
b. Operant conditioning medicines (such as antidepressants) often lead to
c. Observational learning ignored signs of illness. Furthermore, minorities
d. Reinforcement schedules have faced discrimination and biases across social
institutions; they often feel that getting help is not
47. Which of the following attributional terms worth the additional stress it may bring. Educational
would apply if all of the participants in the support and an increase in quality of service would
study had performed the same on both the be valuable in fighting the labeling associated with
first-person and third-person treatments? mental illness in these diverse minority communities.
a. Consistency Mental disorders are extremely common, and
b. Consensus the hope is that as more people let go of the shame
c. Distinctiveness associated with what they are experiencing, labeling
d. Expectation will diminish. The sooner that education, support,
and quality services become available for all, the
sooner those with a mental illness will find hope.

48. What is another word for labeling, as used in

this passage?
a. Stigma
b. Stereotype
c. Ethnocentrism
d. Self-fulfilling prophecy

186
 –M C AT ® E X A M P R A C T I C E T E S T 2–

49. An African-American woman has mild MOST likely reason that two subgroups of
symptoms of bipolar disorder, which she patients of each race were created instead of
ignores to avoid letting her family and friends just one?
know she is sick. Based on the passage, she is a. The researchers wanted to increase the
attempting to avoid all of the following stages number of patients used in the study.
of the illness experience EXCEPT b. There was a control and an experimental
a. visiting the appropriate healthcare subgroup for each race.
professionals. c. In each subgroup, there was a certain set of
b. experiencing illness symptoms. symptoms that could be compared.
c. assuming a sick role. d. The second subgroup was added later
d. being dependent. because the results were not as expected.

50. The woman in the previous question is MOST Use the following image to answer questions 54
likely experiencing which of the following through 56.
symptoms?
a. Forgetfulness
b. Hearing voices
c. Delusions
d. Mood swings

51. Broadly, which of the following is BEST

demonstrated in this passage?
Glial cells
a. Social norms Synapse
b. Deindividuation
c. Social facilitation
Dendrite
d. Bystander effect Nucleus
Axon
Myelin sheath
52. Which of the following factors is LEAST likely
to change the view of illness in minority social
groups?
a. Biotic factors
b. Demographic factors
c. Ideological factors http://www.nichd.nih.gov/news/releases/Pages/012811
d. Environmental factors -communication-between-brain-cells.aspx.

53. A group of patients with psychiatric symptoms 54. The diagram shows many formations of neu-
was divided into four subgroups according to rons. How many major parts are there in a typ-
race to see if their existing race-based attitudes ical neuron?
about their illness would change if they a. 2
received a particular treatment. Two of the b. 3
subgroups were white and two of the c. 4
subgroups were African American. What is the d. 5

187
 –M C AT ® E X A M P R A C T I C E T E S T 2–

55. Which of the following is another name for the Part 4: Critical Analysis
cell body in a nerve cell? and Reasoning skills
a. Axon
b. Dendrite
c. Processes 90 Minutes
d. Soma 53 Questions

56. A man has severe mood swings. Sometimes he is Use the following passage to answer questions 1
happy, oversexualized, a compulsive shopper, through 6.
and aggressive. Other times he is sluggish,
unhappy, tired, and unmotivated. Which part of 1 The only examples of Joseph Haydn’s immense
the brain’s network MOST likely has disruptions 2 work that the present generation knows are two
that cause these severe mood swings? 3 or three symphonies, rarely and perfunctorily
a. Neurotransmitters 4 performed. This is the same as saying that we
b. The brain stem 5 do not know him at all. No musician was ever
c. Soma 6 more prolific or showed a greater wealth of
d. The processes 7 imagination. When we examine this mine of
8 jewels, we are astonished to find at every step a
57. A child can hear a sound that an adult cannot
9 gem which we would have attributed to the
hear. Why is this the case?
10 invention of some modern or other. We are
a. Absolute threshold decreases with age.
11 dazzled by their rays, and where we expect
b. The adult’s auditory pathways are damaged.
12 black-and-whites we find pastels grown dim
c. Feature detection is better in children than
13 with time.
in adults.
14 Of Haydn’s one hundred and eighteen
d. Signal detectors in children function better
15 symphonies, many are simple trifles written
than in adults.
16 from day to day for Prince Esterhazy’s little
17 chapel, when the master was musical director
58. A teacher is using a variable ratio
18 there. But after Haydn was called to London by
reinforcement schedule as a method to
19 Salomon, a director of concerts, where he had a
maintain control of her classroom. This is an
20 large orchestra at his disposal, his genius took
example of which type of learning?
21 magnificent flights. Then he wrote great
a. Classical conditioning
22 symphonies and in them the clarinets for the
b. Operant conditioning
23 first time unfolded the resources from which
c. Cognitive learning
24 the modern orchestra has profited so abun-
d. Modeling
25 dantly. Originally the clarinet played a humble
59. Which of the following is the term used when a 26 role, as the name indicates. Clarinetto is the
specific recollected experience is incorrectly 27 diminutive of clarino, and the instrument was
determined to be the source of a memory? 28 invented to replace the shrill tones that the
a. Source monitoring error 29 trumpet lost as it gained in depth of tone.
b. Neuroplasticity error 30 Like Gluck, Joseph Haydn had the rare
c. Trace decay error 31 advantage of developing constantly. He did not
d. Interference error 32 reach the height of his genius until an age when

188
 –M C AT ® E X A M P R A C T I C E T E S T 2–

33 the finest faculties are, ordinarily, in a decline. 1. Which of the following best captures Camille
34 He astounded the musical world with his Saint-Saëns’ main goal in the passage?
35 Creation, in which he displayed a fertility of a. To highlight the innovations of Haydn,
36 imagination and a magnificence of orchestral unfairly neglected as an important musical
37 richness that the oratorio had never known master
38 before. Emboldened by his success he wrote the b. To argue that Haydn is actually a religious
39 Seasons, a colossal work, the most varied and composer
40 the most picturesque in the history of ancient c. To capture the music of Haydn in vivid
41 or modern music. In this instance the oratorio pictorial language
42 is no longer entirely religious. It gives an d. To encourage modern musicians to perform
43 audacious picture of nature with realistic Haydn’s compositions the way he originally
44 touches which are astonishing even now. There intended
45 is an artistic imitation of the different sounds
46 in nature, as the rustling of the leaves, the songs 2. Judging from the context, Saint-Saëns’ use of
47 of the birds in the woods and on the farm, and the word “picturesque” (line 40) most closely
48 the shrill notes of the insects. Above all that is refers to
49 the translation into music of the profound a. a realistic, factual story, as opposed to
50 emotions to which the different aspects of musical compositions based on stories from
51 nature give birth, as the freshness of the forests, history, religion, or myth.
52 the stifling heat before a storm, the storm itself, b. an oratorio with the most visually striking
53 and the wonderful sunset that follows. Then backdrop paintings.
54 there is a huntsman’s chorus which strikes an c. an oratorio that creates vivid images in the
55 entirely different note. There are grape harvests, mind.
56 with the mad dances that follow them. There is d. a most diverse and unique musical
57 the winter, with a poignant introduction which composition.
58 reminds us of pages in Schumann. But be
59 reassured, the author does not leave us to the 3. Which of the following passage quotes best
60 rigors of the cold. He takes us into a farmhouse supports the argument for the innovative
61 where the women are spinning and where the quality of Haydn’s work?
62 peasants are drawn about the fire, listening to a a. “Of Haydn’s one hundred and eighteen
63 funny tale and laughing immoderately with a symphonies, many are simple trifles”
64 gaiety which has never been surpassed. (paragraph 2)
65 But this gigantic work does not end b. “clarinets for the first time unfolded the
66 without giving us a glimpse of Heaven, for with resources from which the modern orchestra
67 one grand upward burst of flight, Haydn has profited so abundantly” (paragraph 2)
68 reaches the realms where Handel and c. “He did not reach the height of his genius
69 Beethoven preceded him. He equals them and until an age when the finest faculties are,
70 ends his picture in a dazzling blaze of light. ordinarily, in a decline” (paragraph 3)
—excerpt from Musical Memories d. “where we expect black-and-whites we find
by Camille Saint-Saëns pastels grown dim with time” (paragraph 1)

189
 –M C AT ® E X A M P R A C T I C E T E S T 2–

4. Saint-Saëns cites Haydn’s work for Prince a. It strengthens the image of Haydn as a
Esterhazy, in order to show that prolific musician who showed a great wealth
a. wealthy, royal benefactors do not foster great of imagination.
music. b. It weakens Saint-Saëns’ argument that
b. creativity requires the right circumstances genius is born, not made.
and atmosphere for genius to really flourish. c. It weakens Saint-Saëns’ descriptions of
c. he can recognize Haydn’s flaws and is not Haydn’s work as dazzling gems, because
merely effusive about his work. Haydn describes his own work as an active
d. creativity is best fostered when a musician thing that lives in a pulse and a heartbeat.
does not follow outside influences or trends. d. It strengthens Saint-Saëns’ argument that
Haydn suffered from having too many ideas
5. Artists of different genres often influence each and thus created “simple trifles” alongside
other. Haydn’s Seasons was in fact based on a masterpieces.
poem of the same title by James Thomson.
With which of the following statements about Use the following passage to answer questions 7
the interplay of the arts would Saint-Saëns through 12.
most likely agree?
a. The text on which a musical composition is 1 Face to face with an audience, Emma Goldman
based, whether it’s religious, historical, or 2 was a forceful and witty propagandist. Fre-
poetic, is of the utmost importance. 3 quently she lifted her rapt hearers to heights
b. Whether it is drama, music, painting, or 4 from which they envisioned a world wholly free
poetry, the arts are like rival siblings, always 5 and completely delightful. In cold print, how-
seeking to be on the top of a hierarchy of the 6 ever, her lectures reveal little of her dynamic
art forms. 7 appeal. They are primarily the work of a force-
c. One cannot hear a painting, but a piece of 8 ful agitator: clear, pointed, spirited, but without
music has the power to create a painting in 9 originality or intellectual rigor.
the mind. 10 The faithful disciple of Bakunin and
d. Music and painting are much more 11 Kropotkin, Emma perceived civilization as “a
interrelated than music and poetry. 12 continuous struggle of the individual or of
13 groups of individuals against the State and even
6. In his later years, Haydn suffered a physical 14 against ‘society,’ that is, against the majority
decline that made him too weak to play the 15 subdued and hypnotized by the State and State
piano and work out his musical ideas. Suppose 16 worship.” This conflict, she argued, was bound
Haydn wrote in a letter: “Usually musical ideas 17 to last as long as the state itself, since it was of
are pursuing me, to the point of torture, I 18 the very nature of government to be “conserva-
cannot escape them, they stand like walls 19 tive, static, intolerant of change and opposed to
before me. If it’s an allegro that pursues me, my 20 it,” while the instinct of the individual was to
pulse keeps beating faster, I can get no sleep. If 21 resent restriction, combat authority, and seek
it’s an adagio, then I notice my pulse beating 22 the benefits of innovation.
slowly. My imagination plays on me as if I were 23 Her definition of anarchism first appeared
a clavier.” What relevance does this have to the 24 on the masthead of Mother Earth in the issue of
passage? 25 April 1910: “The philosophy of a new social

190
 –M C AT ® E X A M P R A C T I C E T E S T 2–

26 order based on liberty unrestrained by man- 68 No man who has pondered the concept of
27 made law; the theory that all forms of 69 the good life will fail to appreciate the ideal
28 government rest on violence, and are therefore 70 propounded by the anarchists. And one who
29 wrong and harmful, as well as unnecessary.” In 71 has observed the results of modern dictatorship
30 her oft-repeated lecture on the subject she 72 cannot but sympathize with a vision of the
31 warmly described the benefits to ensue from 73 future in which the individual is the prime ben-
32 social revolution: “Anarchism stands for a social 74 eficiary of all social activity. Yet life often makes
33 order based on the free grouping of individuals 75 mock of man’s noblest dreams. Emma may
34 for the purpose of producing real social wealth; 76 have been “the daughter of the dream”; her
35 an order that will guarantee to every human 77 doctrine remains as utopian as it is alluring.
36 being free access to the earth and full 78 There is no gainsaying the fact that modern
37 enjoyment of the necessities of life, according 79 conditions still favor national and industrial
38 to individual desires, tastes, and inclinations.” 80 centralization. The philosophy of anarchism
39 To the end of her life Emma avowed the 81 appears less tenable today than ever.
40 soundness and practicality of her doctrine. As —excerpt from Emma Goldman: Biographical
41 late as 1934 she declared in Harper’s Magazine: Sketch by Charles Allan Madison
42 “I am certain that Anarchism is too vital and
43 too close to human nature ever to die. When 7. Charles Allan Madison’s main purpose in this
44 the failure of modern dictatorship and authori- passage is to
45 tarian philosophies becomes apparent and the a. argue that Goldman was a dangerous
46 realization of failure more general, Anarchism radical.
47 will be vindicated.” It was her belief that sooner b. demonstrate how Goldman failed to create a
48 or later the mass of mankind would perceive following for her political movement.
49 the futility of begging for crumbs and would c. discuss Goldman’s lifelong pursuit of
50 take power into its own hands. Since she anarchist ideals.
51 scorned political means, she expounded the d. argue that Goldman’s lack of intellectual
52 validity of direct action. This method she rigor led to a failed philosophy.
53 defined as the “conscious individual or collec-
54 tive effort to protest against, or remedy, social 8. According to the passage, which of the
55 conditions through the systematic assertion of following is true about Emma Goldman’s view
56 the economic power of the workers.” Once the of anarchism?
57 state and capitalism were destroyed, anarchism a. In the run-up to World War II, fascism
58 would assume the form of free communism, hindered her faith in humanity to self-
59 which she described as “a social arrangement organize and altered her belief in anarchism.
60 based on the principle: To each according to his b. It is indistinguishable from the communist
61 needs; from each according to his ability.” It views of Marx and Lenin.
62 must be stressed that although the wording is c. It was considered dangerous to the American
63 common to all forms of communism, that of government and the capitalist system.
64 Marx and Lenin implies strict centralized d. It is based on the idea that an individual’s
65 authority, while that of Kropotkin and Emma pursuit and interests often stand in
66 Goldman envisions complete decentralization contradiction to the pursuits of a
67 and the supremacy of the individual. government.

191
 –M C AT ® E X A M P R A C T I C E T E S T 2–

9. According to the passage, why has the 12. Which of the following is the best example of
philosophy of anarchism not survived? Goldman’s method of “direct action” (line 52)?
a. Goldman’s best work was done through her a. Protesters occupying Wall Street to oppose
charismatic speeches, and the only thing that economic unfairness and corporate greed
survived her—her unoriginal writing— b. Suffragettes marching in order to gain voting
would not inspire a new generation. rights
b. Individuals are inherently violent and are c. Workers lobbying congress to investigate
therefore aptly represented by a violent unfair labor practices
government. d. An environmentalist chaining herself to a
c. Marxist and Leninist philosophy attracted a tree
greater following.
d. It is based on utopian ideals that could not Use the following passage to answer questions 13
stop the reality of national and industrial through 18.
centralization.
1 The uproar was appalling, perilous to the
10. According to the information in the passage, 2 eardrums; one feared there was too much
which of the following conceptions of Utopia 3 sound for the room to hold—that the walls
sound closest to the ideal society Goldman 4 must give way or the ceiling crack. There were
advocates? 5 high squeals and low squeals, grunts, and wails
a. One in which women rule society 6 of agony; there would come a momentary lull,
b. One in which technology improves living 7 and then a fresh outburst, louder than ever,
and labor conditions so people don’t have to 8 surging up to a deafening climax. It was too
“beg for crumbs” 9 much for some of the visitors—the men would
c. One in which people live in harmony with 10 look at each other, laughing nervously, and the
the natural world 11 women would stand with hands clenched, and
d. One in which all members only do work 12 the blood rushing to their faces, and the tears
they enjoy for the common good 13 starting in their eyes.
14 Meantime, heedless of all these things, the
11. Which of the following aspects of 15 men upon the floor were going about their
transcendentalism aligns with Goldman’s 16 work. Neither squeals of hogs nor tears of visi-
conception of anarchy, as outlined in the 17 tors made any difference to them; one by one
passage? 18 they hooked up the hogs, and one by one with a
I. The idea that political systems corrupt 19 swift stroke they slit their throats. There was a
the individual 20 long line of hogs, with squeals and lifeblood
II. The idea that religious belief is based on 21 ebbing away together; until at last each started
the inner spirit of the human 22 again, and vanished with a splash into a huge
III. The emphasis on individualism 23 vat of boiling water.
a. I and II only 24 It was all so very businesslike that one
b. III only 25 watched it fascinated. It was porkmaking by
c. I, II, and III 26 machinery, porkmaking by applied mathemat-
d. I and III only 27 ics. And yet somehow the most matter-of-fact

192
 –M C AT ® E X A M P R A C T I C E T E S T 2–

28 person could not help thinking of the hogs; 69 was precious, to whom these hog squeals and
29 they were so innocent, they came so very trust- 70 agonies had a meaning? Who would take this
30 ingly; and they were so very human in their 71 hog into his arms and comfort him, reward him
31 protests—and so perfectly within their rights! 72 for his work well done, and show him the
32 They had done nothing to deserve it; and it was 73 meaning of his sacrifice?
33 adding insult to injury, as the thing was done —excerpt from The Jungle by Upton Sinclair
34 here, swinging them up in this cold-blooded,
35 impersonal way, without a pretense of apology, 13. What is Upton Sinclair’s main goal in this
36 without the homage of a tear. Now and then a passage?
37 visitor wept, to be sure; but this slaughtering a. To advocate for vegetarianism
38 machine ran on, visitors or no visitors. It was b. To argue that the industrialization of food
39 like some horrible crime committed in a dun- systems is inherently wrong
40 geon, all unseen and unheeded, buried out of c. To expose the inhumane practices of the
41 sight and of memory. pork industry
42 One could not stand and watch very long d. To show how the fear of death can swoop
43 without becoming philosophical, without upon an individual at any moment
44 beginning to deal in symbols and similes, and
45 to hear the hog squeal of the universe. Was it 14. According to Sinclair, why must one deal with
46 permitted to believe that there was nowhere symbols and similes?
47 upon the earth, or above the earth, a heaven for a. Dealing with the facts of the situation is too
48 hogs, where they were requited for all this suf- disturbing.
49 fering? Each one of these hogs was a separate b. It captures the situation of the
50 creature. Some were white hogs, some were slaughterhouse more vividly than mere
51 black; some were brown, some were spotted; description.
52 some were old, some young; some were long c. It is difficult to face industrial slaughter; one
53 and lean, some were monstrous. And each of wants to give it meaning.
54 them had an individuality of his own, a will of d. The rhythmic nature of the slaughter
55 his own, a hope and a heart’s desire; each was machine is mesmerizing and makes the
56 full of self-confidence, of self-importance, and mind wander.
57 a sense of dignity. And trusting and strong in
58 faith he had gone about his business, the while 15. Sinclair mentions the “god of hogs” (line 68) in
59 a black shadow hung over him and a horrid order to
60 Fate waited in his pathway. Now suddenly it a. say something comical and lighten the mood
61 had swooped upon him, and had seized him by of his philosophizing.
62 the leg. Relentless, remorseless, it was; all his b. highlight the issue of the morality of eating
63 protests, his screams, were nothing to it—it did an animal.
64 its cruel will with him, as if his wishes, his feel- c. appeal to a higher power to stop the
65 ings, had simply no existence at all; it cut his slaughter of hogs.
66 throat and watched him gasp out his life. And d. express the wish that the hog be treated with
67 now was one to believe that there was nowhere care in its life and dignity in its death.
68 a god of hogs, to whom this hog personality

193
 –M C AT ® E X A M P R A C T I C E T E S T 2–

16. Which of the following is the best argument 18. Which of the following critical statements that
AGAINST Sinclair’s sentiments in the deal with the political and ethical aspects of
concluding paragraph? eating and the industrial farm speak most
a. Industrial farms are a vital component in directly to the issues discussed in the passage?
creating enough food to sustain the human a. “We are surrounded by an enterprise of
population. degradation, cruelty, and killing which rivals
b. Hogs squeal for a number of reasons, anything that the Third Reich was capable
including when they enjoy rolling in the of, indeed dwarfs it, in that ours is an
mud. enterprise without end, self-regenerating,
c. We project human emotion onto animals, bringing rabbits, rats, poultry, livestock
which is why we have pets, but a hog does ceaselessly into the world for the purpose of
not possess something like hope or a sense killing them.” (J. M. Coetzee)
of self-importance. b. “The way we eat represents our most
d. These pigs were raised for slaughter; they profound engagement with the natural
would not exist if the machine did not exist. world.” (Michael Pollan)
c. “If possessing a higher degree of intelligence
17. If the following sentence were added to the does not entitle one human to use another
final paragraph, what effect would it have on for his or her own ends, how can it entitle
the passage? “As if in answer to the question, humans to exploit non-humans for the same
looking down this room, one saw a line of purpose?” (Peter Singer)
dangling hogs a hundred yards in length; and d. “Our sustenance now comes from misery.
for every yard, there was a man whose arms We know that if someone offers to show us a
were working as if a demon were after him.” film on how our meat is produced, it will be
a. It would strengthen the idea of a “hog a horror film.” (Jonathan Safran Foer)
heaven” to also introduce the idea of a “hog
hell.” Use the following passage to answer questions 19
b. It would weaken the passage because it through 24.
brings the discussion out of the
philosophical hog heaven and back to the 1 It must be remembered that Spain, in the years
reality of the industrial farm. 2 following her brilliant conquests of the fif-
c. It would strengthen the passage because it 3 teenth and sixteenth centuries, lost strength
brings the discussion out of the 4 and vigor through the corruption at home
philosophical hog heaven and back to the 5 induced by the unearned wealth that flowed
reality of the industrial farm. 6 into the mother country from the colonies, and
d. It would weaken the passage because it 7 by the draining away of her best blood. Nor did
doesn’t provide a direct answer to the final 8 her sons ever develop that economic spirit
question of the passage. 9 which is the permanent foundation of all
10 empire, but they let the wealth of the Indies
11 flow through their country, principally to
12 London and Amsterdam, there to form in more
13 practical hands the basis of the British and
14 Dutch colonial empires.

194
 –M C AT ® E X A M P R A C T I C E T E S T 2–

15 The priest and the soldier were supreme, 56 mixture of both, she has at least—with the
16 so her best sons took up either the cross or the 57 exception only of her great mother, Rome—
17 sword to maintain her dominion in the distant 58 furnished the most instructive lessons in politi-
18 colonies, a movement which, long continued, 59 cal pathology yet recorded, and the advice to
19 spelled for her a form of national suicide. The 60 students of world progress to familiarize them-
20 soldier expended his strength and generally laid 61 selves with her history is even more apt today
21 down his life on alien soil, leaving no fit succes- 62 than when it first issued from the encyclopedic
22 sor of his own stock to carry on the work 63 mind of Macaulay nearly a century ago. Hardly
23 according to his standards. The priest under the 64 had she reached the zenith of her power when
24 celibate system, in its better days left no off- 65 the disintegration began, and one by one her
25 spring at all and in the days of its corruption 66 brilliant conquests dropped away, to leave her
26 none bred and reared under the influences that 67 alone in her faded splendor, with naught but
27 make for social and political progress. The dark 68 her vaunting pride left, another “Niobe of
28 chambers of the Inquisition stifled all advance 69 nations.” In the countries more in contact with
29 in thought, so the civilization and the culture of 70 the trend of civilization and more susceptible to
30 Spain, as well as her political system, settled 71 revolutionary influences from the mother
31 into rigid forms to await only the inevitable 72 country this separation came from within,
32 process of stagnation and decay. In her proud- 73 while in the remoter parts the archaic and out
33 est hour an old soldier, who had lost one of his 74 grown system dragged along until a stronger
34 hands fighting her battles against the Turk at 75 force from without destroyed it.
35 Lepanto, employed the other in writing the —excerpt from Noli Me Tangere by José Rizal
36 masterpiece of her literature, which is really a
37 caricature of the nation. 19. The best title for this passage would be
38 There is much in the career of Spain that a. “Spain and Its Conquests.”
39 calls to mind the dazzling beauty of her “dark- b. “The Priest and the Soldier.”
40 glancing daughters,” with its early bloom, its c. “Progress and the Spanish Inquisition.”
41 startling—almost morbid—brilliance, and its d. “The Fall of the Spanish Empire.”
42 premature decay. Rapid and brilliant was her
43 rise, gradual and inglorious her steady decline, 20. Judging from the context, “political pathology”
44 from the bright morning when the banners of (lines 58–59) could best be described as
45 Castile and Aragon were flung triumphantly a. the expansion of the mother country into
46 from the battlements of the Alhambra, to the many colonies.
47 short summer, not so long gone, when at Cavite b. the systemic problems that lead to the
48 and Santiago with swift, decisive havoc the last decline of a nation.
49 ragged remnants of the once world-dominating c. the lies that the ruling class tell themselves
50 power were blown into space and time, to hover and the nation’s citizens.
51 disembodied there, a lesson and a warning to d. the plague that decimated Spain’s
52 future generations. Whatever her final place in population while also destroying its political
53 the records of mankind, whether as the pioneer structure.
54 of modern civilization or the buccaneer of the
55 nations or, as would seem most likely, a goodly

195
 –M C AT ® E X A M P R A C T I C E T E S T 2–

21. Rizal refers to the “celibacy of priests” as a Niobe becomes a symbol of mourning.
problem for the Spanish Empire. What does he According to the reference in the passage, what
most likely mean? relevance does this myth have to Spain’s
a. Spanish society was overrun with celibate decline?
priests, to the extent that it could not a. The mother country was too boastful of its
produce enough offspring and sustain a colonies.
population in its new colonies, so the empire b. Spain had too many colonies to adequately
waned. care for.
b. Priests could not produce more priests, so c. Spain became mournful for the loss of its
when the empire expanded, the colonies greatness as an empire.
were left without an important part of the d. Spain’s colonies were destroyed from within
motherland’s culture. by “national suicide.”
c. The “celibacy of priests” is a metaphor for
the stifling nature of the religion that held 24. Which of the following factors that led to the
back political and cultural progress in the fall of the Roman Empire also led to the fall of
Spanish empire. the Spanish Empire, as outlined in the passage?
d. The priesthood produced a system of a. Invasions by barbarian tribes
corruption that matched that of the empire’s b. Reliance on slave labor
political leaders. c. The rise of a competing empire
d. Government corruption
22. When Rizal refers to the old soldier who wrote
the masterpiece of Spain’s literature, he refers Use the following passage to answer questions 25
to Cervantes’ Don Quixote. The historical fact through 30.
that one of the masterpieces of Spain came out
of this time period does not align with his 1 Except it be a lover, no one is more interesting
argument that the Inquisition stifled cultural 2 as an object of study than a student. Shakespeare
progress. Which of the following phrases helps 3 might have made him a fourth in his immortal
mitigate this inconvenient historical fact? 4 group. The lunatic with his fixed idea, the poet
I. Framing it as Spain’s “proudest hour” 5 with his fine frenzy, the lover with his frantic
II. Emphasizing that the soldier lost one 6 idolatry, and the student aflame with the desire
hand 7 for knowledge are of “imagination all compact.”
III. Emphasizing that it was a caricature 8 To an absorbing passion, a whole-souled devo-
a. I, II, and III 9 tion, must be joined an enduring energy, if the
b. I only 10 student is to become a devotee of the gray-eyed
c. II and III 11 goddess to whose law his services are bound.
d. III only 12 Like the quest of the Holy Grail, the quest of
13 Minerva is not for all. For the one, the pure life;
23. The Greek myth of Niobe portrays a mother 14 for the other, what Milton calls “a strong pro-
who brags about her plentiful children to the 15 pensity of nature.” Here again the student often
Titan Leto, who only has two children, Apollo 16 resembles the poet—he is born, not made.
and Artemis. Apollo then kills all of Niobe’s 17 While the resultant of two molding forces, the
sons, and Artemis kills all of Niobe’s daughters. 18 accidental, external conditions, and the hidden

196
 –M C AT ® E X A M P R A C T I C E T E S T 2–

19 germinal energies, which produce in each one 61 never happen to a man who has followed step
20 of us national, family, and individual traits, the 62 by step the growth of a truth, and who knows
21 true student possesses in some measure a 63 the painful phases of its evolution. It is one of
22 divine spark which sets at naught their laws. 64 the great tragedies of life that every truth has to
23 Like the Snark, he defies definition, but there 65 struggle to acceptance against honest but mind-
24 are three unmistakable signs by which you may 66 blind students. Harvey knew his
25 recognize the genuine article from a Boojum— 67 contemporaries well, and for twelve successive
26 an absorbing desire to know the truth, an 68 years demonstrated the circulation of the blood
27 unswerving steadfastness in its pursuit, and an 69 before daring to publish the facts on which the
28 open, honest heart, free from suspicion, guile, 70 truth was based.
29 and jealousy. 71 Only steadfastness of purpose and humil-
30 At the outset do not be worried about this 72 ity enable the student to shift his position to
31 big question—Truth. It is a very simple matter 73 meet the new conditions in which new truths
32 if each one of you starts with the desire to get as 74 are born, or old ones modified beyond recogni-
33 much as possible. No human being is 75 tion. And, thirdly, the honest heart will keep
34 constituted to know the truth, the whole truth, 76 him in touch with his fellow students, and fur-
35 and nothing but the truth; and even the best of 77 nish that sense of comradeship without which
36 men must be content with fragments, with 78 he travels an arid waste alone.
37 partial glimpses, never the full fruition. In this —excerpt from The Student Life
38 unsatisfied quest the attitude of mind, the by William Osler
39 desire, the thirst—a thirst that from the soul
40 must rise!—the fervent longing, are the be-all 25. According to the passage, which of the
41 and the end-all. What is the student but a lover following are important qualities that the
42 courting a fickle mistress who ever eludes his student must possess?
43 grasp? In this very elusiveness is brought out his a. Ingenuity and a suspicion of accepted truths
44 second great characteristic—steadfastness of b. Ambition and a thirst for the pure life
45 purpose. Unless from the start the limitations c. Persistence and a captivating desire for
46 incident to our frail human faculties are frankly knowledge
47 accepted, nothing but disappointment awaits d. Courage and an intense love of the
48 you. The truth is the best you can get with your unexpected
49 best endeavor, the best that the best men
50 accept—with this you must learn to be satisfied, 26. Osler mentions Shakespeare’s “immortal
51 retaining at the same time with due humility an group” (line 3). What is the relationship
52 earnest desire for an ever larger portion. Only between the lunatic and the student, according
53 by keeping the mind plastic and receptive does to him?
54 the student escape perdition. It is not, as a. Both deal with the imaginary.
55 Charles Lamb remarks, that some people do b. The lunatic’s ideas are static, whereas the
56 not know what to do with truth when it is student’s are ever changing.
57 offered to them, but the tragic fate is to reach, c. One deals with ideas, whereas the other deals
58 after years of patient search, a condition of with knowledge.
59 mind-blindness in which the truth is not recog- d. Both have a fervent focus.
60 nized, though it stares you in the face. This can

197
 –M C AT ® E X A M P R A C T I C E T E S T 2–

27. Osler cites the work of physician Harvey in d. Descartes’s “If you would be a real seeker
order to show that after truth, it is necessary that at least once
a. one must make absolutely sure of the facts in your life you doubt, as far as possible, all
before publishing. things.”
b. someone may know a truth but may not
have the courage to share it. 30. Aristotle said, “The roots of education are
c. a new truth that changes how we see the bitter but the fruit is sweet.” If we understand
world will be met with opposition. the “fruit” to be the truth gained through the
d. facts will always lead to the truth, even if it learning process, which of the following would
takes time. most likely be Osler’s response?
a. One must have a fervid love for the
28. Osler discusses the “Snark” as the “true cultivation of roots and a thirst for the fruit.
student” and the “Boojum” as the imposter. It b. Some people will not know what to do with
is a reference to Lewis Carroll’s nonsense the fruit when it is offered them.
poem, “The Hunting of the Snark,” in which a c. To the true student, the roots of education
crew sets sail to find the fictional creature. In are sweet and the fruit is bitter.
the end, the crew catch what they think is a d. The true student may skip the cultivation
Snark but which turns out to be a Boojum, a process and go directly to the fruit.
dangerous creature that causes its hunter to
fade away. How else might this tale relate to the Use the following passage to answer questions 31
student and his journey? through 36.
a. It emphasizes the idea of the student’s
journey as the unsatisfied quest for truth. 1 There is no question that the facts of crowd
b. It suggests that the student may be haunted 2 excitement, of class, caste, race, and national
by his imagination when searching for truth. 3 consciousness, show the way in which the indi-
c. It emphasizes that a student should not lose 4 vidual members of a group are, or seem to be,
himself in the pursuit of knowledge. 5 dominated, at certain moments and under cer-
d. It shows that the hunt for knowledge can at 6 tain circumstances, by the group as a whole.
times be nonsensical. 7 Worms gives to this fact, and the phenomena
8 that accompany it, the title “collective con-
29. According to the passage, which of the 9 sciousness.” This gives the problem a name, to
following quotes about truth might Osler agree 10 be sure, but not a solution. What the purpose of
is the most relevant to the student? 11 sociology requires is a description and an
a. Schopenhauer’s “All truth passes through 12 explanation. Under what conditions, precisely,
three stages. First, it is ridiculed. Second, it is 13 does this phenomenon of collective conscious-
violently opposed. Third, it is accepted as 14 ness arise? What are the mechanisms—physical,
being self-evident.” 15 physiological, and social—by which the group
b. Whitman’s “Whatever satisfies the soul is 16 imposes its control, or what seems to be con-
truth.” 17 trol, upon the individual members of the
c. Angelou’s “There’s a world of difference 18 group?
between truth and facts. Facts can obscure 19 This question had arisen and been answered
the truth.” 20 by political philosophers, in terms of political

198
 –M C AT ® E X A M P R A C T I C E T E S T 2–

21 philosophy, long before sociology attempted to 63 This does not explain social control but
22 give an objective account of the matter. Two 64 simplifies the problem of corporate action. It
23 classic phrases, Aristotle’s “Man is a political 65 makes clear, at any rate, that as members of
24 animal” and Hobbes’s “War of each against all,” 66 society, men act as they do elsewhere from
25 omnes bellum omnium, measure the range and 67 motives they do not fully comprehend, in order
26 divergence of the schools upon this topic. 68 to fulfill aims of which they are but dimly or
27 According to Hobbes, the existing moral 69 not at all conscious. Men are activated, in short,
28 and political order—that is to say the organiza- 70 not merely by interests, in which they are con-
29 tion of control—is in any community a mere 71 scious of the end they seek, but also by instincts
30 artifact, a control resting on consent, supported 72 and sentiments, the source and meaning of
31 by a prudent calculation of consequences, and 73 which they do not clearly comprehend.
32 enforced by an external power. Aristotle, on the —excerpt from Introduction to the Science of
33 other hand, taught that man was made for life Sociology by Park and Burgess
34 in society just as the bee is made for life in the
35 hive. The relations between the sexes, as well as 31. Park and Burgess’s use of the phrase “corporate
36 those between mother and child, are manifestly action” (line 64) most closely means
37 predetermined in the physiological organiza- a. the actions undertaken by business
38 tion of the individual man and woman. executives.
39 Furthermore, man is, by his instincts and his b. the movements of the human body that are
40 inherited dispositions, predestined to a social at times involuntary.
41 existence beyond the intimate family circle. c. social control in its simplest form.
42 Society must be conceived, therefore, as a part d. the actions of a group.
43 of nature, like a beaver’s dam or the nests of
44 birds. 32. What is the irony in Park and Burgess’s
45 As a matter of fact, man and society pres- conclusions in the final paragraph about
46 ent themselves in a double aspect. They are at “collective consciousness”?
47 the same time products of nature and of a. The condition of “collective consciousness”
48 human artifice. Just as a stone hammer in the can arise through people’s unconscious
49 hand of a savage may be regarded as an artifi- decisions.
50 cial extension of the natural man, so tools, b. A series of individual wills could be exactly
51 machinery, technical and administrative the same as the collective will of an entire
52 devices, including the formal organization of group.
53 government and the informal “political c. The collective consciousness is actually a
54 machine,” may be regarded as more or less arti- thing that gets scattered.
55 ficial extensions of the natural social group. d. People use the idea as a means of social
56 So far as this is true, the conflict between control, but it is what leads to riots.
57 Hobbes and Aristotle is not absolute. Society is
58 a product both of nature and of design, of
59 instinct and of reason. If, in its formal aspect,
60 society is therefore an artifact, it is one which
61 connects up with and has its roots in nature
62 and in human nature.

199
 –M C AT ® E X A M P R A C T I C E T E S T 2–

33. What is the logical relationship Park and c. It weakens the idea that people are
Burgess present between the “stone hammer” dominated by a group because they are
and the “political machine” (lines 48–54)? dominated by their ancestors instead.
a. The political machine represents modern- d. It strengthens the idea that individuals
day society, which evolved from primitive cannot be influenced by outside forces
man, represented by the stone hammer. unless they offer their consent.
b. They are both extensions of the human
being—one is an extension of the individual, 36. Which of the following would NOT be an
the other of the group. example of collective consciousness, as
c. They are opposites—the stone hammer outlined in the passage?
represents the simple, while the “political a. The shared beliefs of a religious sect
machine” represents the complex. b. The harmony of a symphony
d. The stone hammer was a primitive weapon, c. The inclination to cheer at a political rally
and the “political machine” is a modern d. Being quiet in a library so as not to disturb
weapon. others

34. Which of the following statements best Use the following passage to answer questions 37
expresses Aristotle’s idea of society as outlined through 41.
in the passage?
a. Humans are predestined to interact with 1 Between me and the other world there is ever
society. 2 an unasked question: unasked by some through
b. Human society works cooperatively, like the 3 feelings of delicacy; by others through the diffi-
interworking parts of a machine. 4 culty of rightly framing it. All, nevertheless,
c. Mothers and children form the basis of 5 flutter round it. They approach me in a half-
human society. 6 hesitant sort of way, eye me curiously or com-
d. Human society is like a beaver’s dam that 7 passionately, and then, instead of saying
stops the flow of the natural order of things. 8 directly, How does it feel to be a problem? they
9 say, I know an excellent colored man in my town;
35. Psychologist Carl Jung coined the term 10 or, I fought at Mechanicsville; or, Do not these
“collective unconscious,” which describes the 11 Southern outrages make your blood boil? At these
part of the unconscious made up of inherited 12 I smile, or am interested, or reduce the boiling
ancestral memory and concepts that are 13 to a simmer, as the occasion may require. To the
universal to all humans. What relevance does 14 real question, How does it feel to be a problem? I
this information have to the idea of the 15 answer seldom a word.
collective consciousness as outlined in the 16 And yet, being a problem is a strange
passage? 17 experience,—peculiar even for one who has
a. It strengthens the idea of a group motivated 18 never been anything else, save perhaps in baby-
by similar unconscious desires or instincts. 19 hood and in Europe. It is in the early days of
b. It weakens the idea that consciousness is 20 rollicking boyhood that the revelation first
required to motivate a group. 21 bursts upon one, all in a day, as it were. I

200
 –M C AT ® E X A M P R A C T I C E T E S T 2–

22 remember well when the shadow swept across 61 nation, or beat unavailing palms against the
23 me. I was a little thing, away up in the hills of 62 stone, or steadily, half hopelessly, watch the
24 New England, where the dark Housatonic 63 streak of blue above.
25 winds between Hoosac and Taghkanic to the —excerpt from The Souls of Black Folk by
26 sea. In a wee wooden schoolhouse, something W. E. B. Du Bois
27 put it into the boys’ and girls’ heads to buy gor-
28 geous visiting-cards—ten cents a package—and 37. Judging from the context, the “vast veil” (line
29 exchange. The exchange was merry, till one girl, 35) could best be described as
30 a tall newcomer, refused my card,—refused it a. a disguise that made the exterior world
31 peremptorily, with a glance. Then it dawned elusive.
32 upon me with a certain suddenness that I was b. an invisible barrier that separated blacks
33 different from the others; or like, mayhap, in from whites.
34 heart and life and longing, but shut out from c. a thin, gauzy material used for segregation in
35 their world by a vast veil. I had thereafter no classrooms.
36 desire to tear down that veil, to creep through; I d. a mask that the author lived behind.
37 held all beyond it in common contempt, and
38 lived above it in a region of blue sky and great 38. What does Du Bois mean by living in the
39 wandering shadows. That sky was bluest when I “blue sky and great wandering shadows”
40 could beat my mates at examination-time, or (lines 38–39)?
41 beat them at a foot-race, or even beat their a. One must rise above racism.
42 stringy heads. Alas, with the years all this fine b. He became absentminded in order to forget
43 contempt began to fade; for the words I longed the “problem.”
44 for, and all their dazzling opportunities, were c. One must always look up and see the bright
45 theirs, not mine. But they should not keep these side of things.
46 prizes, I said; some, all, I would wrest from d. He lived mostly in his imagination.
47 them. Just how I would do it I could never
48 decide: by reading law, by healing the sick, by 39. Du Bois’s discussion of the “prison-house”
49 telling the wonderful tales that swam in my most likely argues that
50 head,—some way. With other black boys the a. there is a racial bias in the criminal justice
51 strife was not so fiercely sunny: their youth system.
52 shrunk into tasteless sycophancy, or into silent b. racial inequality is a prison for both whites
53 hatred of the pale world about them and mock- and blacks in America.
54 ing distrust of everything white; or wasted itself c. language is racially tinged by images of light
55 in a bitter cry, Why did God make me an out- and dark.
56 cast and a stranger in mine own house? The d. the barrier between races is insurmountable.
57 shades of the prison-house closed round about
58 us all: walls strait and stubborn to the whitest,
59 but relentlessly narrow, tall, and unscalable to
60 sons of night who must plod darkly on in resig-

201
 –M C AT ® E X A M P R A C T I C E T E S T 2–

40. Which quote from W. E. B. Du Bois most Use the following passage to answer questions 42
closely matches the sentiment of the passage? through 47.
a. “To be a poor man is hard, but to be a poor
race in a land of dollars is the very bottom of 1 A town, such as London, where a man may
hardships.” 2 wander for hours together without reaching the
b. “The chief problem in any community 3 beginning of the end, without meeting the
cursed with crime is not the punishment of 4 slightest hint which could lead to the inference
the criminals, but the preventing of the 5 that there is open country within reach, is a
young from being trained to crime.” 6 strange thing. This colossal centralization, this
c. “It is a peculiar sensation, this double- 7 heaping together of two and a half millions of
consciousness, this sense of always looking 8 human beings at one point, has multiplied the
at one’s self through the eyes of others, of 9 power of this two and a half millions a hun-
measuring one’s soul by the tape of a world 10 dredfold; has raised London to the commercial
that looks on in amused contempt and pity.” 11 capital of the world, created the giant docks and
d. “The problem of the twentieth century is the 12 assembled the thousand vessels that continually
problem of the color-line,—the relation of 13 cover the Thames. I know nothing more impos-
the darker to the lighter races of men.” 14 ing than the view which the Thames offers
15 during the ascent from the sea to London
41. Prominent black Civil Rights leader Booker T. 16 Bridge. The masses of buildings, the wharves
Washington once said of race relations in 17 on both sides, especially from Woolwich
America, “In all things purely social we can be 18 upwards, the countless ships along both shores,
as separate as the five fingers, and yet one as 19 crowding ever closer and closer together, until,
the hand in all things essential to mutual 20 at last, only a narrow passage remains in the
progress.” Based on the passage, which of the 21 middle of the river, a passage through which
following would be Du Bois’s LEAST likely 22 hundreds of steamers shoot by one another; all
response? 23 this is so vast, so impressive, that a man cannot
a. One cannot separate blacks and whites “in 24 collect himself, but is lost in the marvel of
all things social” because we are members of 25 England’s greatness before he sets foot upon
the same society with the same concerns. 26 English soil.
b. The only definition of progress should be to 27 But the sacrifices which all this has cost
tear down the barrier between blacks and 28 become apparent later. After roaming the
whites. 29 streets of the capital a day or two, making head-
c. That which separates us also imprisons us; 30 way with difficulty through the human turmoil
progress cannot be made from the prison 31 and the endless lines of vehicles, after visiting
house. 32 the slums of the metropolis, one realizes for the
d. When one finger is weighed down by the 33 first time that these Londoners have been
dazzling rings of opportunity, the course of 34 forced to sacrifice the best qualities of their
progress shifts in that direction. 35 human nature, to bring to pass all the marvels
36 of civilization which crowd their city; that a
37 hundred powers which slumbered within them

202
 –M C AT ® E X A M P R A C T I C E T E S T 2–

38 have remained inactive, have been suppressed 42. The passage’s central thesis is that
39 in order that a few might be developed more a. science has reduced the human being to a
40 fully and multiply through union with those of collection of atoms.
41 others. The very turmoil of the streets has b. a large group of people, like those found in a
42 something repulsive, something against which city, will necessarily suffer from groupthink.
43 human nature rebels. The hundreds of thou- c. the industrial-urban model of human
44 sands of all classes and ranks crowding past existence sacrifices something essentially
45 each other, are they not all human beings with human for the individual.
46 the same qualities and powers, and with the d. it is ironic that people choose to stay
47 same interest in being happy? And have they squeezed into a city when the “open
48 not, in the end, to seek happiness in the same country” is only just miles away.
49 way, by the same means? And still they crowd
50 by one another as though they had nothing in 43. Judging from the context, the “human turmoil”
51 common, nothing to do with one another, and (line 30) could best be described as
52 their only agreement is the tacit one, that each a. the anguish one feels when surrounded by
53 keep to his own side of the pavement, so as not the cityscape.
54 to delay the opposing streams of the crowd, b. the noise and commotion of the people of
55 while it occurs to no man to honor another the city.
56 with so much as a glance. The brutal indiffer- c. the cost of what is lost of one’s humanity in
57 ence, the unfeeling isolation of each in his a city.
58 private interest becomes the more repellant and d. the war of each individual against the other.
59 offensive, the more these individuals are
60 crowded together, within a limited space. And, 44. Which of the following aspects of city life
61 however much one may be aware that this would Engels agree is a good thing?
62 isolation of the individual, this narrow self- a. The camaraderie felt among its citizens
63 seeking is the fundamental principle of our b. The intellectual life of the city
64 society everywhere, it is nowhere so shamelessly c. The hustle and bustle of city streets
65 barefaced, so self-conscious as just here in the d. None of the above
66 crowding of the great city. The dissolution of
67 mankind into monads, of which each one has a 45. According to Engels, “narrow self-seeking” is a
68 separate principle, the world of atoms, is here fundamental principle of our society because
69 carried out to its utmost extreme. a. city life creates a brutal indifference within
70 Hence it comes, too, that the social war, people.
71 the war of each against all, is here openly b. people are creatures of evolution, each
72 declared. Just as in Stirner’s recent book, people seeking to gain favor in the survival of the
73 regard each other only as useful objects; each fittest.
74 exploits the other, and the end of it all is, that c. people have had to sacrifice their best
75 the stronger treads the weaker under foot. qualities of human nature in order to create
—excerpt from The Condition of the Working- the marvels of civilization.
Class in England in 1844 by Frederick Engels d. isolation is the most natural human quality.

203
 –M C AT ® E X A M P R A C T I C E T E S T 2–

46. Which of the following sights might have 16 exactly the part of the body upon which the
changed his conclusions about society if Engels 17 surgeon is performing the operation. The
had seen it in his walk about London? 18 monochromatic tone of the composition is,
a. The grave of Charles Dickens 19 perhaps, intentional, in order to concentrate
b. An architectural tour 20 the effect on the bloody thigh and the crimson
c. A British library 21 finger of the operating professor. But as it is, the
d. A homeless shelter 22 attention is at once and so entirely directed on
23 that reeking hand as to convey the impression
47. Which of the following examples of animal 24 that such concentration was the sole purpose of
behavior most closely matches Engel’s 25 the painting. In similar paintings by Ribeira,
characterization of humans in the city he 26 Regnault, and other artists of the horrible, as
describes? 27 vivid a result is obtained without sacrificing the
a. The rhesus monkey that fights members of 28 light and color in the other parts of the picture;
its troop for dominance in its social 29 and the effect, while no less intense, is, there-
hierarchy 30 fore, less staring and loud. As to the propriety
b. The bees that engage in cooperative work to 31 of introducing into our art a class of subjects
build honeycombs 32 hitherto confined to a few of the more brutal
d. The vampire bat that engages in “reciprocal 33 artists of the Old World, the question may well
altruism” by sharing food with starving 34 be left to the decision of the public. In color Mr.
members of its species 35 Eakins effects a low tone that is sometimes
d. The bonobo that aids an injured member of 36 almost monochromatic, but has very few equals
its species 37 in the country in drawing of the figure. Some
38 of his portraits are strongly characteristic, and
Use the following passage to answer questions 48 39 give remarkable promise. Miss Emily Sartain is
through 53. 40 devoting herself with good success to genre and
41 portraiture; and Miss Mary Cassatt merits more
1 In Philadelphia the new movement has some 42 extended notice and earnest praise for the glory
2 powerful allies, among whom should be promi- 43 of color and the superb treatment and compo-
3 nently mentioned Thomas Eakins, a pupil of 44 sition of some of her works.
4 Gérôme, and at present professor in the Phila- 45 When we review the various forces now
5 delphia Academy of Art. One of Mr. Eakins’s 46 actively at work to hasten forward the progress
6 most ambitions paintings represents a surgical 47 of American art, we see that they are, with one
7 operation before a class in anatomy. It is char- 48 or two exceptions, still immature; while, on the
8 acterized by so many excellent artistic qualities, 49 other hand, the sum of their influence is such
9 that one regrets that the work as a whole fails to 50 as to prove that they are already sufficiently well
10 satisfy. Admirable draughtsman as this painter 51 established to give abundant promise of vitality,
11 is, one is surprised that in the arrangement of 52 and of a career of success that seems destined to
12 the figures the perspective should have been so 53 carry the arts to a degree of excellence never
13 ineffective that the mother is altogether too 54 before seen in America. While the ideal is a
14 small for the rest of the group, and the figure of 55 more prominent feature of our art than for-
15 the patient so indistinct that it is difficult to tell 56 merly, the tide also sets strongly toward realism,
57 together with a clearer practical knowledge of

204
 –M C AT ® E X A M P R A C T I C E T E S T 2–

58 technique. And while we do not discover 50. Which of the following criticisms of Benjamin’s
59 marked original power in the artists who repre- argument is the WEAKEST?
60 sent the new movement, we find in them a self- a. The discussion of this “new movement”
61 reliance and a sturdiness of purpose which spends too much time criticizing one
62 renders them potential in establishing the end painting, which Benjamin does not even
63 they have in view. It is to their successors that provide the name for.
64 we must look for the founding of a school that b. The discussion of the female painters seems
65 shall be at once native in origin, and powerful tacked on to the end of the first paragraph,
66 in the employment of the material to express as if to pay lip service to the existence of
67 the ideal. women while not actually discussing their
—excerpt from Art in America by Samuel work.
Greene Wheeler (S. G. W.) Benjamin c. Benjamin is overly concerned with American
art, while neglecting the art of other
48. The main purpose of the passage is cultures.
a. to characterize a new movement in d. Realism and idealism are in conflict, yet
American art. Benjamin seems to say that the “new
b. to emphasize the importance of color in movement” embodies both—the
realistic paintings. summations of the final paragraph are
c. to admonish Eakins’s use of brutal subject contradictory and unclear.
matter.
d. to argue that subject is as important as 51. Benjamin does not provide a name for the
technique in painting. “new movement.” Based on the descriptions in
the passage, which of the following paintings
49. What does Benjamin’s use of the word might be included in this “new movement”?
“propriety” (line 30) most likely refer to? a. A painting that draws attention to social
a. He is suggesting that art is meant to be issues of the working class and the poor
beautiful. b. A painting that seeks to capture moods in
b. He suggests that a surgical theater may be an color and abstract form
objectionable subject for an American c. A painting that seeks to represent its subjects
audience. realistically without artificial embellishments
c. He is emphasizing the idea that art is meant d. A painting that seeks to capture visible
to be instructive. brushstrokes and the changing qualities of
d. He is questioning whether it is right to light
introduce new subject matter into a
movement that is still in its infancy.

205
 –M C AT ® E X A M P R A C T I C E T E S T 2–

52. More than a decade later, Eakins painted a sim- Answers

ilar composition of a surgical operation called
The Agnew Clinic, with much brighter lighting Part 1: Biological and Biochemical
and surgeons all dressed in white overcoats. It Foundations of Living Systems
reflected the new practices of antiseptic surgery 1. b. As stated in the passage, the addition of
established in the intervening years between multiple ubiquitin groups to p53 (and to
the two paintings. How does this information proteins in general) directs it to the 26S
affect Benjamin’s discussion of the earlier proteasome complex and results in its
Eakins painting? clearance from the cell.
a. It weakens the idea that Eakins was an 2. a. As stated in the passage, protein
“admirable draughtsman,” because he phosphorylation often occurs in the cytosol,
painted the same composition again. which is the aqueous phase of the cell.
b. It strengthens Benjamin’s analysis that 3. c. As stated in the passage, covalent
Eakins sacrificed color in most of the modifications are dynamic, whereas
painting in order to highlight the blood. proteolytic cleavage is irreversible.
c. It weakens Benjamin’s criticism that Eakins 4. d. Restriction enzyme digest is a method to
sacrificed light, because he may have process DNA for cloning or analysis.
captured the realism of an operation that 5. b. Protein phosphorylation typically occurs on
was not very well lit. serine, threonine, and tyrosine residues.
d. It strengthens Benjamin’s argument, because 6. a. As stated in the passage, glucokinase
Eakins did, in fact, change his style, adding catalyzes the phosphorylation of glucose to
more light to his paintings. glucose 6-phosphate, which is the first step
of glycolysis, or the breakdown of glucose.
53. Which of the following aesthetic theories seem 7. d. This is the correct choice. As stated in the
most important for the author’s view of art? passage, hexokinase I and glucokinase
a. Mimetic—that art is representation, a (hexokinase IV) catalyze the same reaction
mirror held up to the world (phosphorylation of glucose to glucose
b. Pragmatic—that art should teach people 6-phosphate) in different cells of the body.
something They are two of four hexokinase isozymes
c. Expressive—that art is an expression of the (along with hexokinase II and III). Isozyme is
artist, a mirror held up to “the self ” the term for two different enzymes that
d. Objective—that art should be about art catalyze the same reaction.
itself, about paint and the artist’s 8. b. As stated in the passage, glucokinase
brushstrokes converts glucose to glycogen in the liver, and
this process is called glycogenesis.
9. c. This is the correct choice. Allosteric enzymes
function through reversible, noncovalent
binding of regulatory compounds called
allosteric effectors.

206
 –M C AT ® E X A M P R A C T I C E T E S T 2–

10. b. This is the correct choice. Hexokinase I 16. c. Northern blotting is a technique to detect
reaches half of its maximum reaction rate RNA, whereas the products of RACE are
when the concentration of glucose is well cDNAs.
below 5 mM, whereas the maximum 17. d. The distance between two genes (in the map
reaction of glucokinase is still increasing unit of Morgan) is equal to the sum of the
when the concentration of glucose is 5 mM. recombinant frequencies in the progeny:
(Km is the substrate concentration at which 37
0 × (___ 46
) + 0 × (___ 11
) + 1 × (___ 7
) + 1 × (___ )
100 100 100 100
the enzyme has reached half of its maximum
= 0.18 Morgan, or 18 centimorgan.
rate of reaction, or 1.0 relative enzyme
18. d. This choice is correct. There are three
activity.)
possible crossover events: one crossover
11. d. The molar quantities of the different gene
between the first and second gene, one
products need not be the same (because of
crossover between the second and third
different efficiencies of initiation of
genes, and a double crossover. These events
translation).
would give rise to a total of six different
12. b. An inducible operon is turned off in the
recombinant phenotypes (which, in the
absence of the effector (inducer) molecule,
table, are all the phenotypes other than wild-
and a repressible operon is turned on in the
type and crossveinless, echinus, scute).
absence of the effector (co-repressor
Single crossovers would separate the first or
molecule). The effect of the inducer on
third genes from the other two, whereas the
operon activity is negative, although positive
double crossover event would allow the gene
inducible operons have been described as
that is in the middle to assort independently
well.
of the first and third genes. Because a double
13. a. Mutation of the operator (O–) in one chro-
crossover event occurs much more rarely
mosome would remove gene repression in
than a single crossover, the phenotypes that
that copy because the repressor protein
are much less frequent must be the ones
cannot bind to the operator. In the second
where the middle gene phenotype occurs
chromosome, lacZ, lacY, and lacA are
independently of the other two genes’
mutated so they are not expressed. Also, the
phenotypes (cv-sc and ec), revealing which
wild-type operator in that chromosome
gene is in the middle: the ec gene.
(O+) cannot negatively regulate the wild-
19. a. The exchange event occurs during the
type gene copies in the other chromosome
prophase of the first meiotic division.
because the operator cannot act in trans (it
20. b. As stated in the passage, chiasmata are sites
only acts in cis).
where chromosomes remain together after
14. c. This is the correct choice. In the first step of
a crossover event. There is one chiasma in
RACE, the synthesis of negative-strand
the WT image and there are five in the
cDNA depends on a polydT primer binding
syp-1–depleted image.
to the polyadenylation tail in mRNAs.
15. d. RACE requires reverse transcriptase to make
DNA from RNA, whereas PCR requires
DNA polymerase (to make DNA from
DNA).

207
 –M C AT ® E X A M P R A C T I C E T E S T 2–

−
21. d. All interferons have antiviral properties, 30. b. Superoxide anion (O2 ) is the precursor of
including interferon-γ, although its primary most ROS.
action is to activate macrophages. Loss of 31. a. Several groups have addressed the issue of
interferon-γ is associated with decreased causation using an mtDNA polymerase with
resistance to bacterial infection and tumors. eliminated proofreading activity and the
22. a. As stated in the article that reported this polymerase activity preserved.
figure, “Analysis of 120 healthy individuals 32. b. As stated in the passage, it has been
revealed a highly significant difference of speculated that tissues with the highest
female and male PBLs [cells] to produce energy demand are also the most susceptible
IFN-a after TLR7 stimulation with R848 to mitochondrial mutations. Gastrointestinal
(Fig. 2A; p < 0.0000001, two-tailed Mann- tissue has relatively low energy requirements.
Whitney U test). In contrast, IFN-a 33. b. Actin filaments support the transport of
induction in the same females and males cellular material but over much shorter
after TLR9 stimulation with CpG-ODN distances than microtubules.
2216 did not differ significantly (Fig. 2B), 34. d. The top junction is the tight junction.
indicating that preferential IFN-a induction 35. c. Rotavirus protein VP4 induces changes of
in female subjects is TLR7 dependent.” the subapical actin network as the virus
23. c. As stated by Meier et al., “plasma progester- enters cells. An apical point of entry could
one levels were significantly correlated to the be reasoned because the virus is
percentage of IFN-a+ pDCs following gastrointestinal. Because HCV is a blood-
[HIV-1] stimulation.” Levels of progesterone borne virus, it enters through the basolateral
rise during the luteal phase of the menstrual domain.
cycle. 36. c. Adding the soluble extracellular domain of a
24. c. The likelihood of nonwhite women starting cell junction protein over time disrupts trans-
ART is statistically lower (p < 0.05) than that epithelial resistance. However, expressing
of white men. this domain inside cells would not be
25. b. IFN-a plays a central role in hepatitis C predicted to have an effect because this
virus infection, which disproportionately domain would have to be on the outside of
affects men. the cell.
26. b. This is the correct choice. Staurosporine is 37. b. Antibodies targeting E2 and SR-BI and
an apoptosis stimuli that causes soluble heparin only strongly inhibit entry
mitochondria to fragment. when added during the binding phase of
27. c. These steps take place in the mitochondria infection; these factors all play a role in HCV
in eukaryotes. However, aerobic bacteria host cell binding. Antibodies targeting CD81
carry out this process in the cytosol. block infection when added pre- or post-
28. c. NADH (and FADH2, not shown in the binding,indicating that these agents block post-
illustration) is a carrier of high-energy binding HCV cell entry events.
electrons. 38. c. Penetration decreases the risk for immuno-
29. d. The fundamental feature that distinguishes detection because no viral proteins remain
most forms of necrosis from apoptosis is the exposed on the plasma membrane.
rapid loss of cellular membrane potentials. 39. c. Incineration is a method to destroy prions
and decontaminate materials.

208
 –M C AT ® E X A M P R A C T I C E T E S T 2–

40. b. Antibodies can selectively target misfolded 49. d. Osmotic pressure can be calculated using the
proteins while sparing native, properly osmosis equation π = i M R T, where π is
folded protein if, as stated in the passage, osmotic pressure, i is the Van 't Hoff factor,
native protein has important functions in M is molarity, R is the gas constant (0.08206
the cell. L atm mol−1 K−1), and T is temperature.
41. d. Misfolding of prion proteins is associated 50. c. The TIM22 complex is located on the inner
with a change from soluble alpha-helical membrane of the mitochondria, not the cell
conformation to beta-sheet-rich aggregates. surface.
42. c. The aerobic oxidation of glucose forms 30 to 51. a. The conversion of IPP to terpenoids begins
32 ATP molecules. with isomerization to DMAPP.
43. d. Acute pancreatitis is caused by the inability 52. c. The graph shows the highest percentage of
of the pancreas to secrete zymogens to the dMBP staining, which is an indicator of
intestine. As a result, zymogens are myelin degeneration, for tissues from
converted to their catalytic active form individuals with VaD (vascular dementia).
inside the pancreas, which attacks the 53. a. Immunostaining is based on antibody
pancreatic cells. recognition of an antigen. (In the case of this
44. b. This reaction is endothermic, so ∆H > 0. passage, the antigen is degraded myelin basic
Also, two moles of gas has less entropy than protein [dMBP].)
three moles, so ∆S > 0. 54. b. The force that it would take an ion such as
45. c. Flavoproteins that are fully reduced (two Na+ to go spontaneously through an ion
electrons accepted) generally have an channel is ∆G, represented by the equation
absorption maximum near 360 nm, whereas ∆G = RT ln (C inside/C outside) + Z F Vm,
they acquire another absorption maximum where R is the gas constant, T is the
at about 450 nm when partially reduced temperature, C inside/C outside is the ratio
(one electron). of the concentration of the ion inside and
46. b. 16-carbon palmitic acid goes through seven outside the cell, Z is the ion charge, F is the
passes through the oxidative sequence, and Faraday constant, and Vm is the difference in
the overall result is the conversion of the electrical potential. ln (C inside/C outside) is
16-carbon chain of palmitate to eight –2.395.
2-carbon acetyl groups of acetyl-CoA 55. a. The depolarization of cells caused by the
molecules. opening of Na+ channels causes K+ channels
47. a. Progesterone has a ketone group (R2CO), to open, and the K+ efflux repolarizes the
whereas testosterone has an alcohol group membrane locally.
(OH). 56. d. Neurons and endocrine cells respond to
48. c. As explained in organic chemistry, the thick extracellular calcium, which is a second
line represents the trans conformation, messenger, by triggering exocytosis.
whereas the dotted line represents the cis 57. c. The two types of bones have the same
conformation. mineral and matrix components.

209
 –M C AT ® E X A M P R A C T I C E T E S T 2–

58. d. As stated in the footnoted article, the main cyclical hexoses. The half-chair
function of the liver is to process the conformation is less stable than the boat
nutrients absorbed from the small intestine. conformation, the chair conformation is the
59. d. The Wnt/Wingless pathway is important for most stable cyclic carbohydrate
the differentiation of hair. conformation, and the twist-boat
conformation is more stable than both the
Part 2: Chemical and Physical boat and half-chair conformations, but it is
Foundations of Biological Systems less stable than the chair conformation.
1. a. As an approaching source moves closer 4. c. This molecule is a benzene ring with two
during the period of a sound wave, the substituents, CH3 and F, located on adjacent
effective wavelength shortens, and the pitch carbons on the benzene ring.
(frequency) increases accordingly, since the F
velocity of the wave is unchanged. This is an
example of the Doppler effect. The pitch of a
receding sound source will be lowered per H3C
the Doppler effect, and the Venturi effect
The benzene ring of the molecule contains
describes fluid velocity in a pitot tube or a
four hydrogen atoms altogether, and each
constricted pipe.
has a unique set of connections to carbon
2. a. According to Newton’s second law
atoms, which means there are four unique
(F ma), the acceleration of the wagon is
hydrogens and four proton NMR signals
equal to the net force divided by the mass of
contributed by the benzene ring. The methyl
the wagon (a = mF ). To determine the net
group contributes one additional unique
force, the force of friction must be added to
hydrogen, giving a total of five unique
the horizontal component of the applied
hydrogens and therefore five proton NMR
force. The force of friction is given in the
signals. There are four unique hydrogen
question (100 N), so the horizontal compo-
atoms on the benzene ring and one unique
nent (in the x direction) of the applied force
hydrogen atom on the methyl group in this
must be determined. Answer b would be
molecule, so there are five total proton NMR
obtained if sin was used rather than cos.
signals. The two substituents on benzene are
Fhorizontal = F cos(θ) = (240 N)cos50.0° different, giving four unique sets of connec-
= 1.54 × 102 N tions on attached carbons. Additionally, each
F Fhorizontal + Ffriction hydrogen atom on the benzene ring is bonded
a = m = m to a carbon that has a unique set of connec-
1.54 × 10 N + (−100 N)
2
tions, so there are four unique hydrogen
= 500 kg atoms and therefore four proton NMR signals
= 0.108 m / s 2 produced by the 2-methylfluorobenzene ring.
There is one additional proton NMR signal
= 10.8 cm/s 2
produced by the one unique kind of hydro-
gen on the methyl group. Finally, the mol-
3. c. The half-chair conformation is more stable
ecule contains five unique hydrogens and
than the planar conformation, but it is the
therefore five proton NMR signals.
least-stable non-planar conformation for

210
 –M C AT ® E X A M P R A C T I C E T E S T 2–

5. d. The calculation is shown below: for substitutions. No oxygens are

1, 000 g mol contributed directly by the tosyl group. The
1.0 kg × ×
moles of solute
1 kg 342 g sulfur from tosyl does not contribute to the
molality = =
kg of solvent 0.791 g 1 kg functionalized final product, and tosyl
400 mL × ×
1 mL 1,000 g
groups are commonly used as protecting
= 9.2 mol / kg groups; here the tosyl groups would not
encourage PEG hydrolysis.
Choice a is the molarity, not the molality; b 9. c. This structure can be seen in Figure 2. There
is the molarity value with the molality units; is a C = O stretching peak at 1710 cm–1.
and d is the molality value with the molarity There is also a key band at 1,535 cm–1 that is
units. caused by the –NH bending vibration in the
6. c. Hydrophobic moieties are most likely to amide linkage between the silane and the
interact with the hydrophobic interior of PEG, which is not present in any of the other
CDs. The internal cavity of a CD is species in the answer choices. Additionally,
hydrophobic, so positively charged the 1,280-cm–1 peak corresponds to the Si–C
molecules are not the most likely moieties to stretching vibration, which should not be
interact with the inside of a CD cylinder, present in any of the other species. Less
because the internal cavity of a CD is obvious but still useful are the 1,595-cm–1
hydrophobic, negatively charged molecules characteristic benzene ring vibration and the
are less likely to interact with this portion, 817-cm–1 benzene ring bending vibration.
and although amphipathic molecules have Therefore, there are a number of ways to
hydrophobic portions, purely hydrophobic distinguish this spectrum from the other
moieties are most likely with the hydropho- answers. The distinct peak at 1,710 cm–1
bic interiors of CDs. indicates the presence of a carbonyl group.
7. d. The weak base neutralizes the HCl that the As PEG diol contains no carbonyl groups,
reaction generates, and the reaction is an choice a can be ruled out. Additionally, a
SN2 reaction. A weak base is needed to number of key peaks are missing, including
neutralize the HCl generated by the reaction. the peaks at 1,595 cm–1 for characteristic
Adding a weak acid will not accomplish this. benzene ring vibration and at 817 cm–1 for
Also, the reaction is an SN2 reaction, not an benzene ring bending vibration. The Si–C
SN1 reaction. Answer b is an SN2 reaction, and –NH peaks at 1,280 and 1,535 cm–1 are
not an SN1 reaction, and a weak acid, not a also absent. Finally, the distinct peak at 1,710
weak base, must be present to neutralize the cm–1 indicates the presence of a carbonyl
HCl that will be generated in this reaction. group, which would not be present in the
8. c. The CDs replace the tosyl groups on the final b-CD-PEG-MNP product. Addi-
nanoparticles, as shown in Figure 1. This tionally, the glycosidic bond in b-CD-PEG-
occurs because tosylate is a good leaving MNP causes a number of peaks; specifically,
group. Sulfonic acids generally make for peaks at 943.9 cm–1 (a-pyranyl vibration)
excellent leaving groups because their and 1151/1077/1029 cm–1 (C-O-C glycosidic
conjugate bases are quite stable. Tosyl groups bridge stretching vibration) are not present
essentially act as placeholders, preventing in this spectrum that would be present in
reactivity and also serving as leaving groups the spectrum for b-CD-PEG-MNP.

211
 –M C AT ® E X A M P R A C T I C E T E S T 2–

10. d. This is the structure of L-kynurenine. ligand binding to a macromolecule by

The name of the enzyme, indoleamine describing the fraction of macromolecule
2,3-dioxygenase, describes exactly where the saturated by ligand as a function of the
reaction occurs on L-tryptophan, with ligand concentration.
oxygen insertion occurring accordingly. 14. a. Figure 1B shows that Vmax remains constant
The passage explains that the formyl and Km increases, so it is competitive
group is subsequently removed from inhibition. Vmax and Km decrease in
N-formylkynurenine, which results in this uncompetitive inhibition, Vmax decreases
molecule, L-kynurenine. Choice a is the and Km stays the same in noncompetitive
structure of melatonin, b of L-tryptophan, inhibition, and there is no evidence of
the reactant in the IDO1 reaction, and c of irreversible covalent adduct formation here.
dopamine. 15. a. Schwann cells are the main glial cells of the
11. b. The technique allows His-tagged proteins peripheral nervous system. Myelinating
with an affinity for the metal ion to be Schwann cells wrap around axons to form
retained in the nickel column. Protein the myelin sheath. Presynaptic cells are the
separation is not based on size, anion cells at the synapse that release
exchange resins do use positively charged neurotransmitters to stimulate the
groups, the binding principle here is based postsynaptic cells, postsynaptic cells are cells
on affinity, not charged interactions, and that take up neurotransmitters at the
cation exchange resins use negatively synapse, and Langerhans cells are dendritic
charged groups to attract positively charged cells in the skin that capture and process
proteins. microbial antigens in skin infections in
12. a. The best buffer selection is the one whose order to become antigen-presenting cells.
pKa is within 1 pH unit of the desired pH. 16. d. Sphingolipids contain a sphingosine
The only buffer in the table with a pKa backbone that is O-linked to a head group,
within 1 pH unit of the desired pH, 6.5, is which is usually charged. This perfectly
potassium phosphate, which has 7.20 as its describes galactocerebroside, which has a
most useful pKa. The pKa of potassium galactose head group. Sterol lipids include
acetate, Tris, and TEA are all not within 1 cholesterol and are all derived from the same
pH unit of the desired pH of 6.5. fused four-ring core structure, glycerolipids
13. b. The Lineweaver-Burk plot is a double recip- include triglycerides and mono-, di-, and tri-
rocal plot that graphs 1/v as a function of substituted glycerols, and fatty acids are
1/[substrate]. The Eadie-Hofstee diagram carboxylic acids with long aliphatic chains
represents enzyme kinetics by plotting that can be saturated or unsaturated.
reaction rate as a function of the ratio
between rate and substrate concentration,
the Hanes-Woolf plot represents enzyme
kinetics by plotting [substrate]/v against
[substrate], and the Hill plot, based on the
Hill equation, quantifies the cooperativity of

212
 –M C AT ® E X A M P R A C T I C E T E S T 2–

17. b. The large ligand on the hydroxyl at carbon 1 this is not the correct answer. And a
is easily most stable in the equatorial refrigerant causes cooling, which is in no
formation. Moving around the galactose way the function of myelin.
ring would also place the sulfated 20. c. Statements I and III are correct, but
galactocerebroside in the equatorial position. statement II is incorrect because the work
Having both larger cyclical hexose ligands in done by a force in a conservative system is
the equatorial position is the most stable independent of the path taken.
configuration. If the sulfated hydroxyl group 21. b. A path can be constructed from the starting
at carbon 3 is axial, the large ligand on point to the finishing point that features a
carbon 1 is also axial. This is extremely horizontal line across and a vertical line
unstable, the equatorial configuration for down. The horizontal displacement is
the sulfated hydroxyl and the large group at perpendicular to the downward gravitational
carbon 1 is far more stable than the axial force, so no work is done here, but in the
configuration for the groups. Therefore, vertical displacement, the work done is equal
both are not equally stable, and there is no to mgh. According to the work kinetic energy
benzene ring in the structure. The ring is a theorem, the net work done causes an
cyclohexose. increase in velocity, and since the skier began
1
18. b. The strong separation of charge by the at rest, it can be stated that mgh = __ 2
2 m(vf) .
myelin sheath greatly limits ion leakage and The mass value cancels out on both sides
effectively decreases the number of ions that of this equation, and the equation can
must be pumped back after each action be rearranged as vf = 2gh =
potential. The myelin sheath does not cause
any kind of diffusion of sodium and 2 × (9.8 m2 ) × (15.0 m) = 294
s
potassium ions across the axon, there is no = 17.1 m/s.
relationship between the increased 22. d. For a conservative system, the change in
propagation speed and any work done by potential energy is equal to the negative
the axon, and choice d is effectively a amount of work done. If we imagine a
statement of Bernoulli’s principle as it horizontal and vertical path from the
applies to fluids, but it is irrelevant to this starting point to the ending point of the
system because the myelin sheath does not skier’s journey, we can assume that no work
decrease the pressure of the axon as a means is done horizontally because the path is
of increasing impulse speed. perpendicular to the gravitational force, but
19. c. A dielectric material is an electrical insulator for the vertical path, the work done is equal
that can be polarized by an applied electric to mgh. That means that the change in
field. A semiconductor is a solid substance potential energy is equal to –(55.0 kg) ×
with a conductivity between that of an m
s2 ) × (15.0 m) = –8,085 J = –8.09 kJ.
(9.8__
insulator and a conductor. The passage states
that myelin is an insulator, so this cannot be
correct. A cathode is an electrode, and the
role of myelin as an insulator indicates that

213
 –M C AT ® E X A M P R A C T I C E T E S T 2–

23. c. Kinetic energy is equal to __1 2 26. d. The standard curve line equation,
2 m(v) , which in
this conservative system is equal to mgh. determined using the known protein
Since m and g are constant, the highest solutions, can be used to calculate the
kinetic energy will be observed when there is concentration of the protein of interest
the greatest difference in starting and ending because the Bradford assay functions the
heights. This occurs at height 0 m. The skier same way on all proteins, regardless of
will either be motionless or just picking up identity. For general characterization of a
speed at the top of the first hill. Halfway protein, determining the molecular weight is
down the first hill h is equal to 45 m, and the important, and size-exclusion
skier reaches the maximal speed at height chromatography is the way to determine this
zero between the hills. The skier will lose value. However, the molecular weight will
kinetic energy as she ascends the next hill. not be useful for calculating the protein
24. a. This question is essentially asking which of concentration. The mechanism by which the
these amino acids is basic (although binding dye binds the protein does not matter
can also occur to aromatic amino acids), and because the A595 is measured after binding is
of the four, arginine is the only one that fits complete. The spectrum of the red form of
the bill. Histidine and lysine residues are also the dye is not needed for any kind of
basic residues and likely candidates to correction of the measured A595 value.
receive an electron from the dye. Glutamic 27. c. The Bradford assay is nonspecific in its
acid is acidic, so it would not receive a interaction with proteins. Therefore, the
proton from the dye, cysteine is not basic Bradford assay will detect all proteins, not
and would not receive a proton from the dye just the one protein of interest. The molar
molecule, and glutamine is not basic, so the absorptivity is specific to the one protein of
dye would not readily donate a proton to interest. In order to use the Beer-Lambert
cysteine. law, an accurate A and c must be determined
25. c. Binding of dye to the hydrophobic pockets for the protein of interest, which means that
occurs via van der Waals forces, while amine the protein must be extremely pure.
binding to negatively charged dye functional Otherwise, the calculated molar absorptivity
groups occurs via ionic interactions. will not be accurate. The presence of
Hydrogen bonds are not essential here. The cofactors should not influence molar
structure of the dye reinforces this idea, with absorptivity determination using the Beer-
only a limited number of possible H-bond Lambert law, the protein will lose its
donors or acceptors. quaternary structure when bound to the dye,
so the polymeric form is not essential here,
and the Bradford assay is not reliant on
tryptophan residues; its source of
absorbance is not intrinsic to the protein but
rather results from the bound dye.

214
 –M C AT ® E X A M P R A C T I C E T E S T 2–

28. c. SDS is regularly used for cell lysis, a critical overestimation, of the protein concentration.
step in the protein purification procedure. It also will block protein-dye interactions—
SDS detergent is not commonly used in cell it is not likely to enhance interactions due to
growth media; while it is true that SDS is the bulkiness of all molecules involved.
used for protein separation in SDS-PAGE, 31. c. When it comes to absorbance spectra, dyes
SDS-PAGE is not part of a standard of each color will have maximum
purification procedure because it denatures absorbance wavelengths that correspond
the protein. Once a protein sample under- with its opposite color on the color wheel. In
goes the SDS-PAGE procedure, it is not used other words, absorption in the visible region
for purposes like finding concentration via gives the complementary color. According to
the Bradford assay—and SDS is not needed this principle, the red form of the dye will
to stabilize most chromatographic resins. have a maximum wavelength in the green
29. a. The red and green forms of the dye have a range (450 to 560 nm), whereas the green
positive charge, and SDS is an anionic form of the dye will have a maximum
detergent. SDS associates strongly with the wavelength in the red range (640 to 700
red/green form of the dye, causing the dye nm). Even without an electromagnetic
equilibrium to shift. More of the blue form spectrum at hand, the order of the three
of the dye is produced, causing an increase colored dyes’ wavelengths of maximum
in absorbance at 595 nm, independently of absorbance can be determined based on
protein presence. This is the mode of theory alone. 250 nm is UV light, not visible
Bradford assay disruption at high SDS light, and the reverse of choice d is true.
18.9 × 10–6 ___ 2cm2
concentrations. Based on Le Châtelier’s 32. c. ∆A = 2aA∆T = 2 _________ °C π 10.0
2
principle, the absorbance should increase, (50.0°C) = 0.148 cm2. The hole will change
not decrease; based on Figure 1, anionic SDS in size when the brass is heated and answer d
is unlikely to associate strongly with the would be obtained if one used 10.0 cm as
negatively charged blue form of the dye, and the radius rather than the diameter.
anionic SDS is unlikely to associate strongly 33. b. Buoyancy describes the ability of something
with the negatively charged blue form of to float in a fluid and is not relevant here.
the dye. Water progresses up the xylem tubes via
30. b. SDS can bind to the protein via van der transpirational pull, and it is the surface
Waals forces and ionic interactions, tension of water that forms the meniscus,
inhibiting protein binding sites for the dye pulling water up the xylem. Cohesion
reagent and causing underestimation of the describes the ability of molecules or small
protein concentration because the dye is not particles to hold together. Interactions
able to bind protein to its full extent. The between water molecules create the surface
detected absorbance is therefore too low, and tension that makes capillary action possible.
the concentration is underestimated. This is And adhesion describes the ability of
the mode of Bradford assay disruption at molecules or small particles to stick to a
low SDS concentrations. SDS binding to the surface or object. Here, it is just as important
protein inhibits protein binding sites for the as cohesion, because adhesion promotes
dye reagent and causes underestimation, not interaction between the water molecules and
the wall of the xylem.

215
 –M C AT ® E X A M P R A C T I C E T E S T 2–

mv mv 38. c. qsucrose = qwater + qcalorimeter

qB → B = qr
34. b. r = ___ ___

(1.67 × 10–27 kg) × (7.50 × 107 m/s) = mc∆Twater + mc∆Tcalorimeter

= ____________________________
(1.60 × 10–19 C) × (1.00 m) = 0.783 T = (600 g)(4.18 J/g · °C)(10.0°C) + (250 g)
35. d. The Ksp value is a constant and will stay the (20.0 J/g · °C)(10.0°C)
same, and PbCl2 solubility will decrease = 75.1 kJ
because the addition of more chloride to the qsucrose
n = _______ 75.1 kJ
__________
= 5.65
∆H × 103 kJ = 0.0133 mol sucrose
solution will shift the equilibrium to the left, sucrose
342.30 g
increasing the amount of solid PbCl2, per 0.133 mol sucrose × _______
mol = 4.55 g sucrose
the common-ion effect. The Ksp value will Choice a would be obtained if only the
not be affected by ion concentrations. qwater value was used to determine n, b if
36. b. a particles are positively charged, which is only the qcalorimeter value was used to deter-
consistent with the observations in this mine n, and d if the specific heat capacities
experiment. The atomic nucleus is positively were swapped in the equation.
charged, so neutrons would not be repelled 39. b. Residual activity is lowest in the presence of
by the nuclei, b particles are negatively constant DCCD when the Na+
charged, which is inconsistent with concentration is lowest, and residual activity
repulsion by the nuclei, and γ particles have increases as Na+ activity increases. The
a neutral charge, so they would not be activity of the ATPase is highest when no
repelled by the positively charged nucleus. DCCD is present, confirming its role as an
37. a. The first three ionization energies become inhibitor, but Na+ protects against the
increasingly larger, but the fourth ionization inhibition by DCCD. Based on the data, Na+
energy is extremely large because the full is not an inhibitor of the ATPase; in fact, the
electron shell of Al3+ makes it very unlikely data show that the ion combats inhibition of
that Al4+ will form. Ionization energies the ATPase by Na+. DCCD inhibits ATPase,
measure electron removal, not electron but Na+ protects against its inhibition based
addition. Electron addition is described by on the data. Therefore, the two molecules do
electron affinity. No electron excitation is not work cooperatively to inhibit the
involved in ionization energy trends and, in enzyme. Finally, comparing the DCCD-free
many cases, energy and mass are inversely control to any of the trials that include
proportional, but this is irrelevant to the DCCD shows that DCCD is an inhibitor,
ionization energy trends. Additionally, no and increasing the concentration of Na+
significant mass changes are taking place. protects against this inhibition.
40. a. Faraday’s laws of electricity are two-fold, and
this is an accurate statement of the first of
the two laws. The quantities are directly
proportional, not inversely proportional,
and while capacitance is the ability of a
system to store electric charge, this is not
relevant to Faraday’s laws.

216
 –M C AT ® E X A M P R A C T I C E T E S T 2–

41. c. Statement II is correct because liquids have 44. a. The original protein solution can be poured
more entropy (disorder) than solids, and into a dialysis tube, which would then be
statement III is correct because the melting sealed and placed into a large container of
of ice is an endothermic process. Statement I the new buffer. This would be allowed to sit
is false because ice melting at 55°C is for a few hours, allowing the buffers to
spontaneous. exchange. Repeating this process several
42. c. The ideal gas law assumes molecules are times allows for nearly complete buffer
point masses with no volume and with no replacement. Affinity chromatography is
intermolecular attractions. The van der irrelevant here; HPLC allows for molecule
Waals equation corrects for both of these separation but not buffer exchange; and
factors. Phase changes would not be an issue extractions separate solutes based on
in a system that only involves gases, and distribution between two immiscible sol-
chemical bonding is not a factor that the van vents—this is not a method for buffer
der Waals equation covers, neither of these exchange.
factors in choice b is covered by the van der 45. b. At a pH above the pI, proteins carry a net
Waals equation, and the ideal gas law already negative charge. The pH, 5.0, is higher than
accounts for molecular masses, as well as the pI of calmodulin I. Calmodulin I will
pressure in general. carry a net negative charge and will therefore
43. d. Gel filtration chromatography, also called bind to the positively charged anion
size-exclusion chromatography, separates exchange resin. At a pH above the pI,
proteins based on size. Because calmodulin I proteins carry a net negative charge. The
and hemoglobin are so similar in size, the buffer pH (5.0) is lower than the pI of
UV-Vis detector at the bottom of the hemoglobin. Hemoglobin will carry a net
column would likely detect overlapping positive charge and will therefore not bind to
peaks that would be difficult to separate the positively charged anion exchange resin.
without optimization of the technique. Only calmodulin I will bind to the resin.
Paper chromatography separates molecules Hemoglobin will not, and calmodulin I will
on paper based on polarity. The passage bind to the resin, even though hemoglobin
describes a size-based method, so this is not will not.
an appropriate choice. Additionally, SDS- 46. d. The Soret peak is caused by π-π* transitions
PAGE denatures proteins. The passage in the porphyrin ring, which is the heme
describes a method where the proteins bound to hemoglobin. The passage indicates
recovered after size-based separation were that heme is bound to hemoglobin because
collected for further purification and after the heme cofactor was added,
structural analysis, so SDS-PAGE could not hemoglobin successfully bound oxygen. The
have been used. Finally, distillation separates secondary structure of the protein does not
liquids based on boiling points. This cause this particular UV-Vis peak, and
technique is not relevant to this protocol. tryptophan absorbance occurs at 280 nm,
not the 412-nm Soret peak described in the
passage.

217
 –M C AT ® E X A M P R A C T I C E T E S T 2–

47. d. The calculation below shows how this 49. c. The number of gas molecules increases over
answer is obtained using Hess’s law of heat the course of the reaction, increasing the
summation. disorder of the system and therefore
C2H6 g → C2H2 g + 2HC2H6(g) → C2H2(g) + 2H2(g) resulting in a positive ∆S. ∆S does not rely
∆H = +94.5 kJ on the ratio of reactants involved in the
7
2CO2(g) + 3H2O(g) → C2H6(g) + __ reaction, and because the number of gas
2 O2(g)
∆H = +283 kJ molecules increases over the course of the
reaction, ∆S will be positive, not negative.
2H2(g) + O2(g) → 2H2O(g)
50. d. The calculation is shown below, in which the
∆H = –2 × 71.2 kJ = –142.4 kJ
chemical equation is used to find the
--------------------------------------------------------------------------------------------
number of moles produced, and then that
5
2CO2(g) + H2O(g) → 1C2H2(g) + __
2 O2(g) number of moles is used in the ideal gas
∆H = +235 kJ equation to solve for the volume.
×2 4CO2(g) + 2H2O(g) → 2C2H2(g) + 5O2(g)
4CO2(g) + 2H2O(g) → 2C2H2(g) + 5O2(g) 1 mol CO2
5.00 g CO2 × _________
5 mol O2
_________
44 g CO2 × 4 mol CO2 = 0.142 mol O2
∆H = +470 kJ
nRT (0.142 mol) × (0.08206L·atm/mol·K) × 273 K
Choice a would be obtained by adding V = ____
P =
_________________________________
1.00 atm = 3.18 L
together the three ∆H values as they are cur- Choice a would be obtained if 32 K was used
rently, without any manipulation, b if one instead of 273 K, b if the CO2:C2H2 mole
failed to multiply the overall equation by 2 ratio was used instead of the CO2:O2 mole
after the other equations have been added ratio, and c if a 1:1 mole ratio was used.
together, and c if one failed to multiply the 51. d. There are two ligands on the central carbon
third equation by 2. and no lone pairs. There are no lone pairs on
48. a. The limiting reactant is CO2, based on the the central carbon in CO2 that would cause
calculations below, and 2.0 g of CO2 the bent shape, there are not four ligands on
produces 0.59 g C2H2. the central carbon, and the T-shaped
4CO2(g) + 2H2O(g) → 2C2H2(g) + 5O2(g) geometry occurs when there are three
mol mol C2H2
2_________ 26 g ligands and two or three lone pairs. Since
2.0 g CO2 × ____
44 g × 4 mol CO2 × mol = 0.59 g C2H2
____
there are only two ligands and no lone pairs
mol
____ mol C2H2
2_________ 26 g
2.0 g H2O × 18 g × 2 mol H2O × mol = 2.9 g C2H2
____ on CO2, this cannot be the correct shape.
2.0 g H2O × mol 18 g × 2 mol C2H22 mol H2O 52. b. Unlike resistance, resistivity is a material
× 26 g mol = 2.9 g C2H. Choice b would be constant for a particular material and is
obtained if a 1:1 mole ratio was assumed independent of sample dimensions. State
between CO2 and C2H2, when in fact the functions refer to thermodynamic functions
correct mole ratio is 4:2, c if the mole ratio that depend only on the current state of the
between CO2 and C2H2 is flipped from 4:2 system, Figure 1 shows that resistivity is
to 2:4, and d is the theoretical yield from temperature dependent, but resistance is
2.0 g H2O; however, CO2 is the limiting also temperature dependent, and resistance
reactant, so the C2H2 yield should be (R) and resistivity ( ) are related by the
L
calculated from the 2.0 g CO2 reactant. equation = ____A .

218
 –M C AT ® E X A M P R A C T I C E T E S T 2–

53. b. XRD is based on constructive interference of 55. a. Based on the units used on the plot, the
monochromatic X-rays and a crystalline activation energy is equal to the slope of
sample. When the X-rays are directed at a each line multiplied by the Boltzmann
sample, the diffracted rays are collected, with constant (in eV), the y-intercept does not
the angle between the incident and provide a valid means to determine the
diffracted rays being a crucial feature of all activation energy, the x-intercept does not
diffraction. X-ray diffraction (XRD) does provide a valid means to determine the
not provide information about the reactivity activation energy, and this sum does not
of the film, spectroscopic techniques are provide a valid means to determine the
more apt to serve this purpose, but XRD activation energy.
does not detect excited electrons, and 56. b. A purine is a heterocyclic aromatic
though Ni-O bond lengths and bond angles compound consisting of an imidazole ring
are indeed structural features of NiO films, it fused to a pyrimidine ring. Based on Figure
is not the purpose of XRD. 1, this perfectly describes adenosine.
54. d. In semiconductors, as temperature increases, Porphyrins are heterocyclic conjugated ring
more electrons receive kinetic energy and are systems, a pyrimidine is an aromatic hetero-
excited from the valence band into the cycle with a 1,3-diazine (pyrimidine) core—
conduction band. Increased thermal energy it only has one ring, rather than the two
therefore increases current and decreases fused rings a purine has—and a flavin is a
resistivity (per Ohm’s Law). As temperature naturally occurring pigment that has a tricy-
increases in a semiconductor, resistivity clic aromatic molecular structure.
decreases, which is what is seen in Figure 1. 57. c. An exergonic reaction proceeds with a net
The Figure 2 graph is also typical of release of free energy, so ∆G is negative for
semiconductors. Conductors tend to an exergonic reaction. It is true that ATP
increase their resistivity with an increase in hydrolysis is exothermic, but this cannot be
temperature—this is the opposite of what is stated based solely on the ∆G value. ∆G is a
seen in Figure 1—the data here are unrelated measure of the change in Gibbs free energy.
to the magnetic properties of NiO, and The word exothermic is based on ∆H.
insulators are essentially semiconductors Additionally, ∆G°´ describes the change in
with a huge band gap, which means they Gibbs free energy, not the change in
would require a tremendous temperature enthalpy, and an endergonic reaction has a
change for excitation into the conduction positive ∆G°´, and the ATP hydrolysis
band. The resistivity should therefore reaction has a negative ∆G°´.
remain high and constant until this high
temperature change is achieved. Figure 1
shows that resistivity starts to decrease
immediately at 30°C, which is not
characteristic of an insulator.

219
 –M C AT ® E X A M P R A C T I C E T E S T 2–

58. a. ∆Gerythrocytes = ∆G°´ + RTlnK = ∆G°´ Part 3: Psychological, Social, and

[ADP][Pi]
+ RTln ________ kJ/mol + Biological Foundations of Behavior
[ATP] = –30.5
1. b. The amygdala controls anger and rage. The
(0.008314kJ/mol·K)(310 K)ln occipital pole controls vision, the cerebellum
(0.25 × 10–3M)(1.65 × 10–3M)
________________________ controls physical coordination, and the
2.24 × 10–3M = –30.5kJ/mol +
fornix carries signals through parts of the
(2.58kJ/mol)(–8.6) = –30.5kJ/mol + (–22kJ/mol) brain.
= –52kJ/mol 2. d. Venting to other people about the parking
Choice b would be obtained if the concen- problem is an example of an emotion-
trations for ATP and ADP were swapped in focused strategy. In emotion-focused coping,
the K calculation, c if the temperature was the person attempts to remove the anxiety
left in °C rather than Kelvin, and d if the brought about by the stressful situation. The
inverse K was used. man attempts to reduce his anxiety by
59. c. There is actually greater solvation of these venting to friends. Problem-focused coping
molecules relative to ATP, making it involves taking control of the situation that
significantly easier for ATP to lose one of its is causing stress—approaching the neighbor
phosphate groups. The repulsion of the like is an example of problem-focused coping—
charges on ATP is a major reason why while speaking with the apartment complex
breaking the phosphoanhydride bond is so manager is a direct way of taking control of
exergonic, resonance stabilizes ADP more the situation and thus also an example of
than ATP, which contributes to making ADP problem-focused coping. Writing a letter to
a more stable molecule than ATP, and the the apartment association would be the exe-
higher disorder and lower free energy in cution of a plan to take control of the stress-
ADP relative to ATP thermodynamically ful situation and is another example of
explains the observed ∆G°´. problem-focused coping.
3. c. The parietal lobe receives and processes
sensory information from the body. The
frontal lobe controls problem solving and
decision making, the occipital lobe is the
visual processing center, and the temporal
lobe regulates memory.
4. a. The olfactory pathways carry the sense of
smell from the nose to the brain. The optic
nerve carries transduced light from the eyes
to the brain, nerves at the base of the tongue
carry the sensation of taste to the brain, and
sounds travel through many parts of the ear
before reaching the nerves that carry them
to the brain.

220
 –M C AT ® E X A M P R A C T I C E T E S T 2–

5. a. Damage to the frontal lobe would most 10. d. The reference group would be all the other
affect higher-level cognition. Damage to the teachers of the biology course, past and
occipital lobe would most affect visual present. The concept of class identity was
processing, damage to the parietal lobe not a factor in this study; the self-identity
would most affect sensory information from would belong to the graduate student, not
the body, and damage to the temporal lobe the supervisors; and the power group in this
would most affect memory. case would be the supervisor.
6. a. Cognitive dissonance occurs when new 11. c. Parallel processing would allow the brain to
experiences conflict with expectations, determine the color of the dress and differs
causing initial confusion and dissatisfaction. among people, so one person’s brain might
The passage states that the cognitive see blue and black and another’s would see
dissonance was not primarily a problem white and gold. Somatosensation deals
with the students in the class. Cognitive mostly with other areas of the body, includ-
dissonance would not make the supervisors ing the organs, skin, and joints; the color
happy, and there is no indication of of the dress has already been determined
complaints from other student teachers. before it reaches the optic nerve; and
7. a. This study was focused on a single subject auditory processing is associated with the
and therefore was a case study. This study ear and hearing.
had a sample size of n = 1 and thus was not 12. a. The hormones in the endocrine system are
a traditional experimental or a split-half responsible for the fight or flight phenom-
design, and as data collection was via enon. The lymphatic system creates immune
videotape and interview, there were no items cells, the integumentary system is respons-
to equate. ible for exocrine glands, like skin, hair, and
8. b. The supervisors expected the graduate nails, and the cardiovascular system circu-
student to conform to their traditional way lates blood around the body via the heart,
of teaching. There was no indication of peer arteries, and veins, delivering oxygen and
pressure in this study; role playing is prac- nutrients to organs and cells, and carrying
tice, whereas this was an actual classroom; their waste products away.
and social loafing would require the student 13. b. These beliefs are likely to begin turning
teacher to be working in a group, when in around at age 5 to 7 due to brain
fact she was working alone (except with the development. These beliefs are still strong
researcher, who would not be a part of the during the age 4 to 6 range, have already
group in a social loafing situation). started to turn around before the age 8 to 9
9. c. The graduate student’s decision to persevere range, and start to change much younger
despite her supervisors’ cognitive dissonance than the age 10 to 11 range.
is an indication of high self-efficacy. Self-
fulfilling prophecy was not a factor in this
study, stereotypes were not a factor in this
study, and stigma was not a factor in this
study.

221
 –M C AT ® E X A M P R A C T I C E T E S T 2–

14. c. Eastern cultures tend to value their elderly 18. c. The agent of socialization in this case is the
because of the wisdom they provide, workplace. There is no deviance present in
whereas Western cultures tend to value this relationship, collective behavior includes
youth because of their appearance and large groups of people, not just two people,
health. Western cultures also offer financial and this is about individual interaction, not
incentives to the elderly, such as Medicare the larger social norms.
and senior discounts, aging is socially 19. a. Colleague A’s emotions toward Colleague B
constructed in both the East and the West, adapt as he provides support to Colleague B
and Eastern cultures tend to take the view after he loses his job. Universal emotions
that nursing homes show neglect of their relates to facial expressions showing
elderly family members. emotions, the adaptation of emotions in this
15. d. This is a valid argument to the statement passage occurs during adulthood, and the
given in the stem. The statements in a and c brain has completely developed by age 35.
are misinformed, and while b is a commonly 20. d. The limbic system houses the emotions. The
heard objection, it is not related to the cerebellum deals with physical balance, the
question. cerebral cortex is the covering of the brain
16. b. Facebook involves two-way (or more) and deals with memory and perceptual
interactions between people and in some awareness, and the brain stem deals with
cases groups; thus, it is the largest systems that keep humans alive.
contributor to the social construction of 21. c. Piaget developed the larger theory of
reality of all the answer choices given. equilibration that included accommodation.
Television generally communicates in one James and Lange studied emotions, Maslow
direction, and although it adds to the social developed the hierarchy of needs, and
construction of reality in some instances, it Vygotsky viewed learning as socially, not
is not the best answer. Satellite radio may individually, constructed.
contribute to the social construction of 22. b. Assimilation means the brain changes the
reality, but compared to Facebook, it is a new information to fit existing knowledge.
much smaller contributor. And a computer Accommodation is when the brain changes
server is the technology behind computer its structure to fit the new knowledge,
networking, but it does not directly provide equilibration includes both assimilation and
a social environment. accommodation, and stage progression is
17. a. Colleague A is observing Colleague B for not a psychology term.
many years and is using the information to 23. c. The difference in students’ scores from pre-
guide his future attitude toward him. to post-test is the dependent variable in the
Vygotskian theory focuses primarily on the study. The students who received the
development of children, which does not conceptual change instruction were the
apply to this situation, social conflict theory experimental group, b is the independent
has wealth and economics as its basis, and variable, and the teacher who did NOT
rational choice theory suggests that people provide the instruction was in charge of the
always make logical decisions that provide learning of the control group.
them with the greatest benefit and are in
their highest self-interest.

222
 –M C AT ® E X A M P R A C T I C E T E S T 2–

24. a. When learners go through the process of 27. c. This is an example of bottom-up processing
challenging their misconceptions, they often using perceptional inputs. Choices a, b, and
experience cognitive dissonance, which is d are examples of top-down processing.
described in the stem of the question. While 28. a. Breast development in boys occurs in
there is some negative feedback involved, the response to rising estradiol levels. The oppo-
BEST theory to fit the model is cognitive site of b is true, menarche is the first onset of
dissonance. In the behaviorist model, teach- menstruation in girls, and myelinization
ing goes from teacher to student based on occurs in the brains of boys and girls.
the tabula rasa idea—challenging miscon- 29. b. The basic idea of a fundamental attribution
ceptions is not part of behaviorist instruc- error is to think someone’s intentions are
tion—and the biopsychosocial approach is malicious when they are not. The example in
within the paradigm of illness and medicine choice a is the opposite of a fundamental
and not part of the conceptual change attribution error, c has more to do with self-
model. concept than a fundamental attribution
25. d. The educational system is the agent of error, and d is a self-fulfilling prophecy, not
socialization MOST responsible for resis- a component of a fundamental attribution
tance to change, because most instruction error.
goes from teacher to student and the con- 30. c. The Internet is not a social institution. Parts
ceptual change model includes the student of the Internet are used in mass media,
to a much greater extent. The student is which is often considered a social institution,
expecting to be told the science concepts, but the Internet itself is not. Marriage is part
not have them challenged. Although science of the family and, thus, a type of social insti-
concepts may be talked about in the home, tution; education includes schools, which
the school is most responsible for a student’s are social institutions; and government is a
resistance to change; the media may have social institution.
some effect on the student’s resistance to 31. a. Autophagy impairment as described in the
change, but the school’s influence is much passage would be slowed in neuron cells.
greater; and peers are likely to have little Autophagy impairment as described is
effect on a student’s resistance to change. slowed, not speeded up; cell destruction
26. d. Dissatisfaction is most likely to invoke would not occur abruptly, as this is a long-
attitude change because of the emotions term process; and if cell destruction stopped
involved in having misconceptions altogether, the patient would become
challenged. Intelligibility is unlikely to terminal.
invoke any attitude change. Depending on 32. c. Autophagy (protein misfolding) would
the concept (e.g., evolution), there may be a increase the personality disorder behaviors.
significant attitude change, but this is likely Mania symptoms would increase when
to be the case with only a few concepts, so autophagy is impaired, Parkinson’s disease
dissatisfaction is a better answer. And while symptoms would worsen, and drug abuse is
fruitfulness may invoke happy feelings, the often associated with autophagy
attitude change will be far less than with impairment.
dissatisfaction.

223
 –M C AT ® E X A M P R A C T I C E T E S T 2–

33. a. The control group did NOT receive the 39. d. The best practice would be to keep all
therapy. The treatment group DID receive variables the same and repeat the
the therapy, choice c is a description of a experiment with a new set of subjects. The
dependent variable, not the control group, proper procedure would be to continue to
and the researchers performing the study investigate the same problem, it would not
were not a group in the study. be good experimental practice to reuse the
34. c. Social reproduction relates to systems that same groups when repeating the experiment,
keep generations of a family within the same and when repeating the experiment, both
social status. Intersectionality relates to groups should be the same size.
intersections of systems of oppression, class 40. a. The looking-glass self theory states that a
consciousness relates to the beliefs of an person’s identity is an outgrowth of his or
individual about his or her class status, and her interactions with others and perceptions.
intergenerational mobility relates to social Role taking is when a person takes on the
status change within a family. role of another person to interpret a
35. a. Privileged status is based on inheritance of situation, imitation is when a person’s
property; oppressed status is based on identity comes from imitation of others, and
reproducing new workers. Oppressed status reference group is not an identity formation
is based on reproducing new workers, not theory.
the maintenance of the privileged women, 41. b. Differential association theory does not
privileged women are also oppressed, and explain why individuals become criminals.
the status of privileged women is not based Strain theory focuses on why they become
on human reproduction. criminals, collective behavior focuses on the
36. b. Both are higher than in the privileged class. group, not the individual, and labeling
37. a. Oppressed women often do not have access theory is associated with the development of
to quality health care because of where they a sense of self in all people, not just
live and a lack of transportation. The illness criminals.
experience is a description of the stages or 42. b. Interpersonal attribution has to do with
sequence of being ill, medicalization is the interactions between two or more persons.
process through which a specific illness External attribution has to do with the sur-
becomes an illness in the medical rounding events; although common sense is
community, and the sick role can change a a component of attributional theory, there is
person’s social status during his or her no such thing as common sense attribution;
illness. and correspondent inference has to do with
38. d. One group is being discriminated against by how individuals make sense of situations—
another group. In this passage, no aggression there is no psychological concept called cor-
is evident, in-group and out-group deal with respondent inference attribution.
the individual, not the group, and prejudice
has to do with bias.

224
 –M C AT ® E X A M P R A C T I C E T E S T 2–

43. a. Because the methodology led to an 48. a. Labeling is a synonym for stigma in this
improvement in intergroup functioning, it passage. Stereotyping typically comes from
can be hypothesized that the use in trying to outside one’s cultural group; ethnocentrism
reduce prejudice may be fruitful. Because the is judging a cultural group outside one’s
methods had a positive effect on the own; and self-fulfilling prophecy is the
participants, it is unlikely that they would opposite of what is occurring here.
reduce self-efficacy; the passage states that 49. b. The woman is having symptoms of bipolar
the third-person perspective improved the disorder that she cannot control. She is
outcome, so it is unlikely to affect the inter- ignoring her illness, which means she is
actions in a negative way; and cognition is avoiding health care, is avoiding
likely to be increased when these methods experiencing a sick role, and is avoiding
are used. letting others know she is sick and thus is
44. d. The first-person and third-person not relying on others for help.
perspectives were the independent variables 50. d. Mood swings are common in individuals
in the research study. The control group is with bipolar disorder. Forgetfulness is a sign
the group that received no treatment, the of dementia-type diseases such as Alzheimer’s
experimental variable is the group that and Parkinson’s, and although some
received the treatment, and the dependent individuals with advanced bipolar disorder
variables are looked at to determine the might experience psychosis, including
outcome of the research study. hearing voices, as well as delusions, this
45. a. The name of the experimental group in patient is having mild symptoms.
sociological terms is the primary group. The 51. a. It is a social norm in some cultural groups to
secondary group is most likely the group the ignore symptoms of illness because of the
primary group visualized interacting with, stigma attached. Deindividuation relates
the out-group refers to a group of excluded primarily to large groups such as crowds,
people, which does not apply to any group social facilitation is the phenomenon where
in this study, and a triad consists of three performance is altered due to the presence
people and does not apply to this study. of another person or other people, and the
46. c. The learning in the experimental group is bystander effect is when a group of people
occurring through modeling and observation. witness a person in need of help but do not
Classical conditioning does not occur in this attempt to help.
study, there are no rewards or punishments in 52. d. Environmental factors, including events that
this study, and no reinforcement schedules are few and far between, such as earthquakes
are used in this study. and floods, are unlikely to induce change
47. b. The correct term in this case is consensus, around the stigma of disease. Spread of
because all of the participants performed the disease is a biotic factor and is likely to cause
same. Consistency refers to a single social change around the illness experience,
individual’s consistency of performance or birth and death rates from particular
thought, distinctiveness would have to do diseases are likely to influence cultural views
with a single person being distinct from the of disease, and ideology about diseases can
others, and expectation does not apply to cause social change about the stigma that
this experiment. surrounds them.

225
 –M C AT ® E X A M P R A C T I C E T E S T 2–

53. b. There was a control group for each race. If 59. a. Source monitoring errors occur when a
the researchers wanted to increase the recollected experience is incorrectly
number of patients used in the study, they determined to be the source of the error.
would add more patients to the original two Neuroplasticity is the brain’s ability to change
subgroups; the various symptoms could be based on experience, trace decay error is the
compared using one subgroup each; and if fading of short-term memories over time, and
the results were not as expected, the interference occurs when long-term memories
researchers would most likely run a are interfered with by new information.
follow-up study to investigate the findings.
54. c. The typical neuron has four major parts. It Part 4: Critical Analysis and
may look like there are two, three, or five Reasoning Skills 
parts in some of the images, but in the 1. a. The opening sentences set up the idea that a
typical neuron, there are four. large body of Haydn’s work has been
55. d. Soma is another name for the cell body. neglected and that what is played is
Axons conduct electrical impulses away “perfunctorily performed.”
from the neuron’s cell body or soma, 2. c. While the term picturesque usually describes
dendrites conduct electrical impulses toward something visual, like a painting or a
the neuron’s cell body or soma, and the landscape, Saint-Saëns has described how the
function of a process is to be a conduit sounds of the musical composition mimic
through which signals flow to or away from sounds in nature, almost as if you could
the cell body. imagine the natural scene as you listen.
56. a. The man’s symptoms indicate a possible 3. b. One of the specific innovations Saint-Saëns
diagnosis of bipolar disorder, which is most mentioned in the passage was Haydn’s use of
likely caused by disruptions in the clarinet, which had previously only
neurotransmitters. The brain stem is not the played a “humble role” in the orchestra.
location of the biological processes that 4. b. Saint-Saëns emphasizes that once Haydn
cause mental illness, mental illness is not began creating music for a larger audience in
caused by disruptions in the soma, and London, his musical genius took “magnificent
disruptions in the processes do not cause flights,” implying that a change in his
mental illness. circumstances is what allowed his genius to
57. a. Absolute threshold decreases with age. flourish.
Although auditory pathways relate to hear- 5. c. Saint-Saëns spends a lot of time describing
ing, choice b is not why the child hears the images of the music of Haydn. This
something the adult does not hear, feature statement most closely aligns with his views
detection is related to vision, and choice d is of Haydn’s Seasons, so it is likely he would
not an example of signal detectors. agree with this statement.
58. b. Reinforcement schedules are a part of oper- 6. a. The letter portrays a composer whose
ant conditioning. Variable ratio reinforce- imagination and ideas proliferate despite his
ment is not a part of classical conditioning, declining health and physical ability to do
choice c is an example of behavioral learn- his work. This seems to support Saint-Saëns’
ing, not cognitive learning, and d is not an view of Haydn as prolific, with a wealth of
example of modeling. imagination.

226
 –M C AT ® E X A M P R A C T I C E T E S T 2–

7. d. In the opening paragraph, Madison 14. c. When faced with the hog’s death, over and
mentions the lack of intellectual rigor in over again, Sinclair (along with his readers)
Goldman’s writing, but elsewhere in the is forced to consider the hog’s death more
passage he does not focus on this flaw as an closely to give it meaning, which is the main
overarching problem for the movement. purpose of the final paragraph.
8. d. Madison examines Goldman’s belief that 15. d. The mention of a “god of hogs” is a wish
what is natural to a government is unnatural that the hog could have some alleviation of
to the individual and that government its suffering and that its life and death had
fundamentally goes against human nature. meaning.
9. d. In the final paragraph, where Madison 16. c. This choice most closely addresses what Sin-
discusses Goldman’s legacy as the “daughter clair is doing in the final paragraph, which is
of the dream,” he mentions that “modern to anthropomorphize the hogs.
conditions” favor centralization but is vague 17. c. The sentence sets up an equation between
as to the nature of those conditions. the treatment of the hogs and the working
However, it is logical to conclude that reality conditions of the man. To bring the
(whatever the conditions of reality may be) discussion back to the reality of the farm
has gotten in the way of the idealism of strengthens Sinclair’s overall purpose in
anarchism. exposing the conditions of the industry.
10. d. This society sounds closest to Goldman’s 18. d. The passage focuses on the misery of the
definition of anarchy, which values “social hogs and likens the process to some
wealth” or the “common good.” “horrible crime committed in a dungeon,”
11. d. Goldman’s philosophy is most critical of which sounds similar to the “horror film”
government and its negative effects on the Jonathan Safran Foer describes here.
lives of individuals. Her definition of 19. d. Rizal discusses a number of issues that led to
anarchism emphasizes the “free grouping” of the fall of the Spanish empire, so this is the
individuals to produce “social wealth.” While most likely choice.
Goldman’s definition does advocate for a 20. b. A pathology is an illness, so the metaphor
social group, it also advocates for the suggests a dysfunction in the way Spain was
interests of the individual. led. Rizal cites Rome, another empire that
12. a. Goldman discusses protesting social enjoyed a great rise and a sharp decline, as
conditions through the “assertion of well as Spain’s history as teachable lessons in
economic power.” Both Goldman and the “how not to rule a country.”
protesters share a concern for economic 21. c. Rizal speaks in metaphor when he discusses
disparity. both the priest and the soldier; they are
13. c. This answer is closest to the meaning of the symbols of war and religion. In this
passage. Sinclair describes the process of paragraph, Rizal moves between the literal
pork making as “some horrible crime and the metaphorical quickly and even
committed in a dungeon, all unseen and mixes metaphors, but the overall intent of
unheeded, buried out of sight and of his paragraph is that neither religion nor
memory,” and then begins to philosophize war helped the advance of the Spanish cul-
about the hog’s poor existence. ture—in fact, they hurt the empire.

227
 –M C AT ® E X A M P R A C T I C E T E S T 2–

22. a. In framing the piece of literature as the 29. a. Osler makes the point in the second
Spanish empire’s “proudest hour,” Rizal paragraph that all truth has to “struggle to
acknowledges that something good arose acceptance” as a warning to the student
from this empire in decline but also portrays against what he calls “mind-blindness” but
it as a singular event. Mentioning the fact also to describe the process of sharing truth
that Cervantes was a soldier who lost one with the rest of the world (as in the case of
hand makes it seem like the war-waging Harvey).
empire failed to aid this writer but that he 30. a. The author’s discussion seems to portray a
created the masterpiece in spite of his injury. student as one who loves the process of
The fact that the literature is an exaggeration learning as much as the end results.
of the country’s defects supports Rizal’s view 31. d. The term “corporate” commonly refers to
that the empire suffered from many flaws. business corporations but in this case simply
23. c. In context, Rizal emphasizes a country that means “group.”
mourns the loss of what it once had. 32. a. The final paragraph emphasizes that people
24. d. The first flaw of the Spanish empire can act without being fully aware of their
mentioned in the passage is corruption. motives.
25. c. Osler emphasizes three main qualities— 33. b. The authors set up a comparison between a
steadfastness, a desire for knowledge, and an simple example of a man with a stone
open heart—in addition to other qualities, hammer who is natural and artificial at the
like humility and honesty. same time to the more complex example of
26. d. In context, Osler does not simply compare the extension of a group.
the lunatic with the student but groups them 34. c. In Aristotle’s view of society, it is an
together with the lover and the poet. The instinctual aspect of the human that “man is
lunatic clings to an idea, whereas the student made for life in society.”
is “aflame with desire.” The word “fervent” 35. a. Jung’s ideas, which offer an explanation of
seems the closest in meaning to Osler’s unconscious motives, strengthen the idea
point. that a group may be moved by unconscious
27. c. Osler’s emphasis is on how “every truth has motives.
to struggle to acceptance.” Harvey’s idea of 36. b. While the symphony is made up of players,
blood circulation is an obvious truth now the harmony is a group of notes that exists
but had to be very carefully introduced to beyond human consciousness.
physicians. 37. b. The vast veil is a separation along racial
28. a. Osler emphasizes that the thirst for lines, which speaks to the crux of W.E.B.
knowledge, the quest for the truth, is more Du Bois’s main topic of discussion.
important for the student than being 38. a. The metaphor is about looking beyond the
concerned with the end result—the “fervent artificial racial barriers set up in society. The
longing” is the “be-all and the end-all.” sky was bluest when Du Bois succeeded and
excelled at things despite facing racism.

228
 –M C AT ® E X A M P R A C T I C E T E S T 2–

39. b. The “problem,” as Du Bois outlines in his 47. a. The monkey’s fight for dominance in its
discussion, disproportionately affects the troop is similar to the “social war” Engels
black community, but this image indicates describes and the “strong treading the
that it is a problem for all society. weaker underfoot.”
40. d. The “color line” is similar to the “veil” Du 48. a. S.G.W. Benjamin spends a good amount of
Bois described earlier and pinpoints the time discussing a particular work of Eakins’s,
issues of the relationship between blacks and but the discussion begins with an attempt to
whites. While he frames the issue as being a characterize a new movement in art, moves
problem, the “problem” discussed in the on to include work by a couple of other
quote is very similar. painters, and concludes with a description of
41. a. Du Bois spends time discussing the invisible the characteristics of the movement.
barrier that separates blacks from whites and 49. b. This is the issue Benjamin pinpoints. After
would probably not insist that such a analyzing the image of an operation and
separation is logically impossible. mentioning other artists of the “horrible,” he
42. c. Engels describes the crowding of the city, declares he will leave the question of
saying that the people who live there have whether or not it is right to show such a sub-
been “forced to sacrifice the best qualities of ject up to the public.
their human nature” and goes into some 50. c. The purpose of the essay is to discuss and
detail about how the city instills a sense of define a new movement in American art.
indifference within them. Therefore, Benjamin must focus on it. Ben-
43. b. Turmoil means commotion or disturbance, jamin also, in fact, does mention artists of
and this is what the author most closely other cultures (i.e., Ribeira and Regnault).
means in context. 51. c. Benjamin critiques things like perspective
44. d. Even when Engels speaks of the city’s view of and lighting, which suggests the “new move-
the Thames with a certain amount of awe, it ment” is inclined toward realism, valuing
is described as impressive but also imposing. how accurately the artist represents her
He does not highlight many beneficial subject.
aspects of the city. 52. c. The differences between the two composi-
45. c. In creating great things, the things of tions are the lighting and the establishment
civilization, which is the advanced state of of antiseptic practices. If Eakins was a realist
human society, Engels argues that human painter, then he may have been capturing
beings have had to sacrifice their best qualities the reality of the lighting of darker-lit
and that as many as a “hundred powers” figures.
within human beings have been suppressed. 53. a. Benjamin spends most of his time discussing
46. d. Engels mentions walking through slums, the Eakins painting, and his critique focuses
which may reflect a society that is on how accurately the painter captured his
characterized by “narrow self-seeking.” The subject in terms of perspective, lighting, and
homeless shelter is a public good that has little color.
to do with selfishness and may be one sight
that would have countered the author’s views.

229
–n o t e s –
notes