General Biology 2 Q3-M1 Genetics
General Biology 2 Q3-M1 Genetics
NOT
General Biology 2
Quarter 1 - Module 1
GENETICS
Name: _______________________________________________________________
Grade Level/Strand:_________________________________________________________
1
Module 1
Genetics
What This Module is About
2
11. Identify the unique/ distinctive characteristics of a specific taxon relative to other taxa
(STEM_BIO11/12IIIhj 15)
12. Describe species diversity and cladistics, including the types of evidence and procedures that can
be used to establish evolutionary relationships. (STEM_BIO11/12IIIhj-16).
Lesson
Genetic Engineering
1
What I need to know
Learning Competency
What I know
Definition of Terms:
1. Genetic Engineering 6. Genome
2. DNA 7. Gene Mapping
3. Recombinant DNA 8. Biotechnology
4. Plasmids 9. Polymerase Chain Reaction
5. Cloning 10. Gene Therapy
What’s is it
INTRODUCTION:
Genetic engineering, the artificial manipulation, modification, and recombination of
DNA or other nucleic acid molecules in order to modify an organism or population of
organisms.
The term genetic engineering initially referred to various techniques used for the
modification or manipulation of organisms through the processes of heredity and
reproduction. As such, the term embraced both artificial selection and all the
interventions of biomedical techniques, among them artificial insemination, in vitro
fertilization (e.g., “test-tube” babies), cloning, and gene manipulation.
https://www.britannica.com/science/genetic-engineering
Genetic engineering involves the use of molecular techniques to modify the traits of a
target organism. The modification of traits may involve:
1. introduction of new traits into an organism
2. enhancement of a present trait by increasing the expression of the desired gene
3. enhancement of a present trait by disrupting the inhibition of the desired genes’ expression.
A general outline of recombinant DNA may be given as follows:
1. cutting or cleavage of DNA by restriction enzymes (REs)
2. selection of an appropriate vector or vehicle which would propagate the recombinant
DNA ( eg. circular plasmid in bacteria with a foreign gene of interest)
3. ligation (join together) of the gene of interest (eg. from animal) with the vector (cut
bacterial plasmid)
4. transfer of the recombinant plasmid into a host cell (that would carry out replication to
make huge copies of the recombined plasmid)
5. selection process to screen which cells actually contain the gene of interest
6. sequencing of the gene to find out the primary structure of the
protein Ways in which these plasmids may be introduced into
host organisms:
Biolistics. In this technique, a “gene gun” is used to fire DNA-coated pellets on plant
tissues.
Cells that survive the bombardment, and are able to take up the expression plasmid
coated pellets and acquire the ability to express the designed protein.
4
Some methods are:
Selection of plasmid DNA containing cells
Selection of transformed cells with the desired gene
PCR detection of plasmid DNA
Genetically Modified Organisms (GMOs)
POST QUIZ:
1. Determine which technologies are most appropriate for which cell types.
1. Plants cells
2. Electroporation
3.Biolistics
4. Bacterial cells
5. Mammalian cells
What’s I can do
PERFORMANCE TASK:
PROS CONS
1.
2.
3.
4.
5
Lesson Discuss the Applications of
2 Recombinant DNA
Learning Competency:
The learners should be able to discuss the applications of Recombinant
DNA Technology (STEM_BIO11/12-III a-b-7)
What I know
What’s is it
INTRODUCTION:
There are many different traits that can be introduced to organisms to change their
properties. The following table shows examples of modified traits using cloned genes and
their applications:
6
MODIFIED TRAIT GENE RECIPIENT APPLICATION
MODIFICATION ORGANISM (FIELD)
7
PCR Amplification
Once a desired trait is chosen, information must be acquired for either its detection or
expression in a given organism.
1. Detection
Some researchers may be interested in determining if a given gene/trait is available
in a particular organism. If no previous research provides this information,
researchers may test the DNA of different organisms for the presence of these
specific genes. A technique that allows the detection of specific genes in target
organisms is called PCR.
PCR amplification is an in-vitro method that simulates DNA replication in vivo. It
utilizes a thermostable (heat-resistant) DNA polymerase that builds single stranded
DNA strands unto unwound DNA templates.
PCR uses repeated cycles of incubation at different temperatures to promote the
unwinding of the DNA template (~95°C); the annealing of a primer (a ~20bp
oligonucleotide sequence (recall RNA primers in DNA replication) onto the ssDNA
template strand (~54 - 60°C); and the extension of the generated ssDNA strand
through the binding of complementary bases to the template strand (~72° C). The
thermostability of the polymerase allows it to survive the repeated cycles of
denaturation, annealing and extension with little loss of enzyme function. Each cycle
of PCR doubles the amount of the target sequence. A typical PCR experiment
uses about 35 cycles of amplification. This increases the original amount of the target
sequence by 235 (i.e. ~34 billion) times.
Gene detection by PCR involves the design of primers that would only bind to
sequences that are specific to a target. For example, researchers would want to find
out if gene X (e.g. the gene for insulin) is available in a target organism (e.g. a
mouse, Mus musculus). Primers may be designed by looking at the available
sequences for gene X in the databases (e.g. all the genes for insulin in different
organisms; humans, pigs, cows, etc.). The different gene X sequences must be
aligned/ compared to match areas of sequence similarity (conserved sequences) and
areas of sequence dissimilarity (non-conserved sequences). Primers designed to
have the same sequence as the conserved areas will be specific for binding gene X
sequences in all the target organisms. Primers designed to have the same sequence
as the non-conserved areas will only be specific for the organisms which match its
sequence.
8
Step 2: Primer Annealing ; Temp ~ 54 °"C (dependent on primer melting
temperature); Template: ssDNA strands. H-bonds are formed between complementary
sequences on the primers and the target sequences.
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand)
Direction of elongation CCATAGATC (Reverse Primer)
New Strand 1:
5’ A T GCGATGAGGATATGACCCGATAGATAGAGGTATCTAGAGAT 3’ (Coding strand) (old)
3’ CGCTACTCCTATACTGGGCTATCTATCTCCATAGATC-5’ (Reverse Primer) (new)
New Strand 2:
5’ GCGATGAGGATATGACCCGATAGATAGAGGTATCTAG-3’ (Forward Primer) (new)
3’ T A CGCTACTCCTATACTGGGCTATCTATCTCCATAGATCTCTA 5’ (Non-coding strand) (old)
PCR Applications
9
What’s more
ACTIVITY:
10
Lesson History of Life on Earth
3
What I need to know
Learning Competency
The learners describe general features of the history of life on Earth, including
generally accepted dates and sequence of the geologic time scale and
characteristics (STEM_BIO11/12-IIIc-g-8)
What I know
11
What’s is it
INTRODUCTION:
https://clarkscience8.weebly.com/geologic-time-scale.html
12
The Geological Time Scale (GTS)
CAMBRIAN EXPLOSION is the belief that there was a sudden, apparent explosion
of diversity in life forms about 545 million years ago. The explosion created the
complexity of multi-celled organisms in a relatively short time frame of 5 to 10 million
years. This explosion also created most of the major extant animal groups today.
1. Unaltered preservation - Small organism or part trapped in amber, hardened plant sap
2. Permineralization/ Petrification - The organic contents of bone and wood are
replaced with silica, calcite or pyrite, forming a rock-like fossil
3. Replacement - hard parts are dissolved and replaced by other minerals, like
calcite, silica, pyrite, or iron
4. Carbonization or Coalification - The other elements are removed and only the
carbon remained
5. Recrystalization - Hard parts are converted to more stable minerals or small crystals
turn into larger crystals
6. Authigenic preservation - Molds and casts are formed after most of the organism have
been destroyed or dissolved.
13
DATING FOSSILS
Knowing the age of a fossil can help a scientist establish its position in the geologic time scale
and find its relationship with the other fossils. There are two ways to measure the age of a
fossil: relative dating and absolute dating.
1. RELATIVE DATING
Based upon the study of layer of rocks
Does not tell the exact age: only compare fossils as older or younger, depends on their
position in rock layer
Fossils in the uppermost rock layer/ strata are younger while those in the lowermost
deposition are oldest
2. ABSOLUTE DATING
• Determines the actual age of the fossil
• Through radiometric dating, using radioactive isotopes carbon-14 and potassium-40
• Considers the half-life or the time it takes for half of the atoms of the radioactive
element to decay
• The decay products of radioactive isotopes is stable atoms.
14
What’s I’ve learned
4. The movie “Jurassic Park” got its title from which era?
A. Paleozoic
B. Mesozoic
C.Cenozoic
D. Holozoic
15
8. The geologic time scale is subdivided into 4 groups. List
them from the largest to the smallest.
A. Eons, periods, epochs, eras
B. Eras, eons, periods, epochs
C.Epochs, periods, eras, eons
D. Eons, eras, periods, epochs
RECOMMENDEDREADINGS
1.https://flexbooks.ck12.org/cbook/ck-12-middle-school-life-science-
2.0/section/4.13/primary/lesson/timeline-of-evolution-ms-ls/
2.https://flexbooks.ck12.org/cbook/ck-12-middle-school-earth-science-flexbook-
2.0/section/15.7/primary/lesson/geologic-time-scale-ms-es/
3.https://www.ck12.org/book/ck-12-earth-science-concepts-for-high-
school/section/10.7/
16
Lesson Mechanisms that Produce
4 Change in Populations
Learning Competency
The learners shall be able to explain the mechanisms that produce change in populations from
generation to generation (STEM_BIO11/12-IIIc-g-9)
What I know
PRIOR KNOWLEDGE:
What’s new
PRE ACTIVITY: A Picture Paint a Thousand Words
Answers:
17
https://www.dogalize.com/2016/12/dog-breeds/
https://blogs.scientificamerican.com/observations/the-concept-of-race-is-
a-lie/
What’s is it
INTRODUCTION:
Hardy–Weinberg law The law that states that in an infinitely large, interbreeding
population in which mating is random and in which there is no selection, migration, or
mutation, gene and genotype frequencies will remain constant from generation to
generation. In practice these conditions are rarely strictly present, but unless any
departure is a marked one, there is no statistically significant movement away from
equilibrium. Consider a single pair of alleles, A and a, present in a diploid population
with frequencies of p and q respectively. Three genotypes are possible, AA, Aa, and
aa, and these will be present with frequencies of p2, 2pq, and q2 respectively.
https://www.encyclopedia.com/science-and-technology/biology-and-genetics/genetics-and-genetic-
engineering/hardy-weinberg-
law#:~:text=Hardy%E2%80%93Weinberg%20law%20The%20law,generation%2C%20with%20no%20o
verlap%20b etween
The five conditions that must be met for genetic equilibrium to occur
include:
18
The Hardy-Weinberg equation is a mathematical equation that can be used to
calculate the genetic variation of a population at equilibrium. he equation is an
expression of the principle known as Hardy-Weinberg equilibrium, which states that the
amount of genetic variation in a population will remain constant from one generation to
the next in the absence of disturbing factors.
p2 + 2pq + q2 = 1
where p is the frequency of the "A" allele and q is the frequency of the "a" allele in the
population. In the equation, p2 represents the frequency of the homozygous genotype AA,
q2 represents the frequency of the homozygous genotype aa, and 2pq represents the
frequency of the heterozygous genotype Aa. In addition, the sum of the allele frequencies for
all the alleles at the locus must be 1, so p + q = 1. If the p and q allele frequencies are known,
then the frequencies of the three genotypes may be calculated using the Hardy-Weinberg
equation.
https://www.nature.com/scitable/definition/hardy-weinberg-equation-299/#:~:text=Science%20at%20Scitable-
,Hardy%2DWeinberg%20equation,In%201908%2C%20G.%20H.&text=If%20the%20p%20and%20q,using%20the%2
0Hardy% 2DWeinberg%20equation.
Natural selection, genetic drift, and gene flow are the mechanisms that cause
changes in allele frequencies over time. When one or more of these forces are acting
in a population, the population violates the Hardy-Weinberg assumptions, and
evolution occurs.
Natural selection occurs when individuals with certain genotypes are more likely
than individuals with other genotypes to survive and reproduce, and thus to pass on
their alleles to the next generation. As Charles Darwin (1859) argued in On the Origin
of Species, if the following conditions are met, natural selection must occur:
Mutation. Although mutation is the original source of all genetic variation, mutation
rate for most organisms is pretty low. So, the impact of brand-new mutations on allele
frequencies from one generation to the next is usually not large. (However, natural
selection acting on the results of a mutation can be a powerful
mechanism
evolution!
)
19
Natural selection. Finally, the most famous mechanism of evolution! Natural
selection occurs when one allele (or combination of alleles of different genes) makes
an organism more or less fit, that is, able to survive and reproduce in a given
environment. If an allele reduces fitness, its frequency will tend to drop from one
generation to the next. We will look in detail at different forms of natural selection that
occur in populations.
Gene flow. Gene flow involves the movement of genes into or out of a population,
due to either the movement of individual organisms or their gametes (eggs and sperm,
e.g., through pollen dispersal by a plant). Organisms and gametes that enter a
population may have new alleles, or may bring in existing alleles but in different
proportions than those already in the population. Gene flow can be a strong agent of
evolution.
Non-infinite population size (genetic drift). Genetic drift involves changes in allele
frequency due to chance events – literally, "sampling error" in selecting alleles for the
next generation. Drift can occur in any population of non-infinite size, but it has a
stronger effect on small populations. We will look in detail at genetic drift and the
effects of population size.
20
Lesson Evolution and Origin of
Biodiversity: Patterns of Descent with
5 Modification
The learners shall be able to show patterns of descent with modification from common
ancestors to produce the organismal diversity observed today.
STEM_BIO11/12-IIIc-g-10
What I know
PRIOR KNOWLEDGE: Definition of Terms
1. Species 6. Allopatric
2. Classification 7. Sympatric
3. Interbreeding 8. Parapatric
4. Isolating mechanism
5. Zygote
What’s new
PRE ACTIVITY: Answer the following questions briefly.
1.
2.
3.
4.
5.
21
B. Identify the different kind of variants of
the species.
Example:
Specie: Cat
Kinds or Variants: Lion, Tiger, Cheetah
Specie Kinds of Variants
1.
2.
3.
4.
5.
What’s is it
INTRODUCTION:
22
B. Sympatric speciation (sym – same, patric – place; ‘same place’) - occurs when
members of a population that initially occupy the same habitat within the same range
diverge into two or more different species. It involves abrupt genetic changes that
quickly lead to the reproductive isolation of a group of individuals. Example is change
in chromosome number (polyploidization).
C. Parapatric speciation (para – beside, patric – place; ‘beside each other’) – occurs
when the groups that evolved to be separate species are geographic neighbors.
Gene flow occurs but with great distances is reduced. There is also abrupt change in
the environment over a geographic border and strong disruptive selection must also
happen.
23
What’s I’ve learned
POST QUIZ:
2.
3.
1.
2. Temporal or Seasonal Isolation
2.
3.
1.
3. Behavioral Isolation
2.
1.
4. Mechanical Isolation
2.
1.
5. Gametic Isolation
2.
3.
24
25