Basic Concepts in Systems Biology

Systems Biology Course 2024 – Lecture 1

 Outline
What is Systems Biology?
Why Systems Biology?
Potential application of Systems Biology
How can we implement the Systems Analysis?
What do we need to know?
What are the key features of biological networks?
Network reconstruction – multi-dimensional annotation
Systems Biology: the process
 What is Systems Biology?
• Systems biology is the study of biological systems
by identifying the components of a living system,
understanding how those parts fit together, and
determining how the parts function as a whole.
• It seeks to identify how biological functions evolve
and how emergent properties in cells and
communities arise from seemingly simple, linear
genetic sequences.
• Systems biology is an interdisciplinary field that
combines the knowledge and techniques from
biology, biochemistry, genomics, bioinformatics,
chemistry, and computational science, but what
makes it different from these other fields is
modeling.
 Component vs. Systems Biology

Reductionist Integrative
Approach Approach
(Genome Sequencing, (Bioinformatics, Systems
DNA Arrays, Proteomics) Science, Modeling,
Simulation)

20th Century 21st Century

Biology Biology
 Systems Analysis Approach

A system:

Its components:
 Why Systems Biology?
An enormous amount of biological components is available. High
throughput technologies have advanced significantly in the recent
years. Thus we can now acquire an understanding of the wiring
diagrams of life.

Microbial systems are suitable for implementing a systems analysis

• Their cultivation is easier
• They can be grown asexually
• They have relatively small genome
• They are very dynamic – encounter many diverse conditions
• They are compact and are multi-scale – molecular function, sub-
cellular function, cellular function
• They are good platforms for studying emergent properties
• They offer insight into cellular life as individual cells and
members of a cell community
 Potential Application of Systems Biology

Agricultural – meat production and animal

disease, epidemiology of disease, and
pathogen transport, aquaculture, plant
agriculture

Medical – Identifying drug targets, overcoming

antibiotic resistance, managing the emergence
of new diseases, identifying antibiotics in multi-
drug strategies, studying pathogen ecology
and managing hospital acquired infections
 Industrial and Environmental Applications
Energy production – Novel energy production systems,
commercial microbial hydrogen generation, BIO-
batteries.
Metabolic engineering – Commercial bioreactors and
the products derived from organisms.
Biocontrol – To control undesired microbial populations
Pollution and bioremediation – Water and soil quality
management.
Bioterrorism and decontamination – Detect the release
and prevent the spread of these microbes.
Global monitoring – As the most numerous and diverse
life forms on this planet, the activities of microbes and
microbial communities can be used as sensitive
reporters of local or planetary changes in temperature,
greenhouse gases, pollutants, etc.
 Inside Cell

Genomics

Transcriptomics
Proteomics

Metabolite A Metabolite B
Reaction X

Number of molecules
per unit time through
Metabolomics reaction Fluxomics
(mmol gdw-1 h-1)
 From Genomics to Genetic Circuits

DNA Sequence ACTGTCGAACTGGACTTCAGCTTGATCGGAACGTCAATCGACTACGTAGTCAT

Composition
ORF identification

Genes geneA geneB geneC geneD

ORF assignment

Structure
Gene Products A B C D

coordinated function

Integrated function
P

expression
Genetic Circuits P

mRNA
Genetic Circuits Applications
 Outline

What is Systems Biology?

Why Systems Biology?
Potential application of Systems Biology
How can we implement Systems Analysis?
What do we need to know?
What are the key features of biological networks?
Network reconstruction – multi-dimensional annotation,
1D and 2D
Systems Biology: the process
 Biology is now asking:
If every molecule in a cell
is replaced over time, is it If every cell in an organism is
still the same cell? replaced over time, is it still the
same organism?
 The answer basically is ‘yes’
Thus, the interconnections of biological
components--the ‘blueprint,’ the ‘circuit
diagrams’--of cells are taking center stage in
biology:

and thus... we have the emergence of systems

biology
 Two Key Questions Arise:

• What is the nature of the links between the components in

a biological network?
– Molecular biology – chemical reactions
– Tissues – gap junctions
– Sociology – ‘friendship,’ ‘married’
• What are the functional states and properties of biological
network?
– Constrained by basic physico-chemical laws
– Selected by evolution
– Many (equivalent) states
 Links to Networks
• Reactions link together to form a network
• The basic structural features are bi-linear and they are a
‘tangle of cycles’ representing key chemical properties
• As network size grows, the number or possible functional
states grows faster than the number of components
• Multi-functionality of networks leads to multiple possible
states (‘behaviors’ or ‘phenotypes’)
• Multiple possible phenotypes call for the selection of
‘states’ (‘optimal’) based on network history and
survival
• Built-in mechanisms (‘regulation’) are needed to choose
(‘express’) the selected states
 Some Key Features of Biological Networks

• They have a ‘sense of purpose’ (objective) which

fundamentally is ‘survival’ (natural selection)
– Are they algorithmic?
• They evolve – i.e. they are time-variant
– Key difference from P/C sciences
– Principally through kinetics and changing available/active links
– Evolution is a process of ‘tinkering’ – a posteriori predictions
Three Equivalent Options for Printing
 Tinkering Towards Complexity

Basic Elements… Complex Systems

C
G
T
A
Characteristics of Genetic Circuits
Multi-’Dimensional’ Annotation
• 1D
– Traditional genome annotation
– Component enumeration
• 2D
– Component interactions, network reconstruction
– Systemic annotation
• 3D
– Spatial organization of cells
• 4D
– Genome evolution and plasticity
• Systems Biology vs. Genome Biology
 1D Annotation
Distribution of E. coli proteins among 22 functional groups
(simplified schema) (Blattner et al.)
Functional class Number % of total
Metabolism
Central intermediary metabolism 188 4.4%

Use sequence analysis to Carbon compound catabolism

Amino acid biosynthesis and metabolism
Nucleotide biosynthesis and metabolism
130
131
58
3.0%
3.1%
1.4%
locate ORF and to assign Fatty acid and phospholipid metabolism
Biosynthesis of cofactors, prosthetic groups and carriers
48
103
1.1%
2.4%

function to the gene Energy Metabolism

Putative enzymes
Total Metabolism
243
251
1152
5.7%
5.9%
26.9%

product Transport
Transport and binding proteins 281 6.6%
Putative transport proteins 146 3.4%
Total Transport 427 10.0%
Regulation
Regulatory function 45 1.0%
Putative regulatory proteins 133 3.1%
Total Regulation 178 4.2%
Structure
Cell structure 182 4.2%
Putative membrane proteins 13 0.3%
Putative structural proteins 42 1.0%
Total Structure 237 5.5%
Macromolecules
DNA replication, recombination, modification and repair 115 2.7%
Transcription, RNA synthesis, metabolism and modification 55 1.3%
Translation, posttranslational protein modification 182 4.2%
Total Macromolecules 352 8.2%
Phage, transposons, plasmids 87 2.0%
Cell processes (including adaptation, protection) 188 4.4%
Putative chaperones 9 0.2%
Other known genes 26 0.6%
Hypothetical, unclassified, unknown 1632 38.1%
Total 4288 100.0%
 2D: Network Reconstruction

Metabolic Regulatory Signaling

Integrated but incomplete

 From Component to Systemic (2D) Annotation:
Fundamental to Systems Biology

Links

protein-protein DNA-protein
-1 " "
Regulatory
-1 " " interactions
1 " "

" -1 "
Direct
" -1 " gene products

" 1 "

B metabolites A " " -1 Effects

on other
A B " " 1
compounds
Component
interactions
Component Systemic (2D) annotation
Genome
sequence
(1D) annotation

Nature Biotechnology Oct 2004

Development of the E. coli Metabolic Network

(104 )

(906 )

Today

Reed and Palsson, Journal of Bacteriology 2003

 Available Models

• Escherichia coli Many versions

• Haemophilus influenzae Second generation
• Helicobacter pylori Second generation
• Saccharomyces cereviciae Second generation
• Geobacter sulfurreducens
• Bacillus subtilis
• Staphpylococcus aureus
• Methanosarcina bakeri
• Pseudomonas (two strains)
• Streptomyces coelicolor
• Asperogillus niger Biochemistry only
• Human cardiac mitochondria Proteomics based
• Mouse Core metabolism
Genome-scale map of S. cerevisiae

SimPheny, Genomatica Inc, San Diego

Escherichia coli Metabolism
 Mathematical Representation of a
Biochemical Network

Stoichiometric Matrix
reaction
-1 0 -1 0 -1 0 0 0
metabolite
1 -1 0 0 0 -1 0 0

0 1 1 -1 0 0 -1 0
S= 0 0 0 1 0 0 0 -1

0 0 0 0 -1 0 0 0
1 0 0 0 1 0 0 0

With the network represented in matrix form, its properties can be mathematically assessed
While there is one matrix -- there are many ways to draw the map.
 Lysine Biosynthesis
Example of Integrated Reconstruction Process :
• Genome annotation reveals incomplete pathway for lysine biosynthesis
• Gap analysis indicates no other routes for lysine production
• Growth physiology data indicates no auxotrophic requirement for lysine
Non-Gene
• Three additional reactions will be included into the model to complete pathway Associated
• These reactions represent hypotheses for future investigation Reactions

Gene Associated Reactions

 http://systemsbiology.ucsd.edu/organisms/yeast.html
Reaction and Metabolite Lists

Maps and GPR Associations

Supplementary Data Files

E. Coli 1.0 - all reactions, full connectivity – regular map - hierarchical layout
E. Coli 1.0 – intrasystem reactions, full connectivity – regular map – uniform edge length layout
E. Coli 1.0 – intrasystem reactions, primary connectivity only – regular map – uniform edge length layout
E. Coli 1.0 – all reactions, full connectivity – simplified map – random layout
E. Coli 1.0 – all reactions, full connectivity – simplified map – uniform edge layout (from two different initial configurations)
E. Coli 1.0 – all reactions, full connectivity – simplified map – hierarchical layout

overview
E. Coli 1.0 – all reactions, full connectivity – simplified map – hierarchical layout

detail middle right part – with orthogonal links

 Systems Biology: The Process

1. Components gen- transcript- prote- metabol- …etc.

Plurality of omics
2. Reconstruction
“Systemic annotation” reconstruction of biochemical reaction network
one set of reactions
arising from the genome

3. in silico modeling …etc.

topology constraints dynamics sensitivity noise
plurality of methods

1. Hypothesis generation Simulation Experiment

and testing
-CHiP-Chip
-Fluxomics phenotypic space
“practically infinite”
for most organisms
 Overview
What is Systems Biology?
Study of biological components and how they function as a whole

Why Systems Biology?

Biological components and high throughput technologies are available

Potential application of Systems Biology

Industry, medicine, agriculture, etc.

How can we implement the Systems Analysis?

What do we need to know? The components and interactions
What are the key features of biological networks? objective,
multiple solutions, evolution, etc.
Network reconstruction – multi-dimensional annotation, 1D (using
the ORF) and 2D (network reconstruction)

Systems Biology: the process