KEMBAR78
Edger Users Guide | PDF | Coefficient Of Variation | Gene Expression
0% found this document useful (0 votes)
204 views105 pages

Edger Users Guide

This document provides a user's guide for edgeR, an R package for analyzing digital gene expression data. It introduces edgeR's capabilities for differential expression analysis of RNA-Seq data using negative binomial models. The guide covers topics such as normalization, estimating dispersion, performing comparisons between experimental groups, and handling complex experimental designs involving multiple factors. It also provides a case study on using edgeR to analyze an RNA-Seq dataset comparing oral carcinomas to matched normal tissue.
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
0% found this document useful (0 votes)
204 views105 pages

Edger Users Guide

This document provides a user's guide for edgeR, an R package for analyzing digital gene expression data. It introduces edgeR's capabilities for differential expression analysis of RNA-Seq data using negative binomial models. The guide covers topics such as normalization, estimating dispersion, performing comparisons between experimental groups, and handling complex experimental designs involving multiple factors. It also provides a case study on using edgeR to analyze an RNA-Seq dataset comparing oral carcinomas to matched normal tissue.
Copyright
© © All Rights Reserved
We take content rights seriously. If you suspect this is your content, claim it here.
Available Formats
Download as PDF, TXT or read online on Scribd
You are on page 1/ 105

edgeR: differential expression analysis

of digital gene expression data


Users Guide

Yunshun Chen, Davis McCarthy,


Matthew Ritchie, Mark Robinson, Gordon K. Smyth

First edition 17 September 2008


Last revised 10 April 2017
Contents

1 Introduction 5
1.1 Scope . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
1.2 Citation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
1.3 How to get help . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
1.4 Quick start . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8

2 Overview of capabilities 9
2.1 Terminology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
2.2 Aligning reads to a genome . . . . . . . . . . . . . . . . . . . . . . . . . . . 9
2.3 Producing a table of read counts . . . . . . . . . . . . . . . . . . . . . . . . . 9
2.4 Reading the counts from a file . . . . . . . . . . . . . . . . . . . . . . . . . . 10
2.5 The DGEList data class . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
2.6 Filtering . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 11
2.7 Normalization . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
2.7.1 Normalization is only necessary for sample-specific effects . . . . . . . 12
2.7.2 Sequencing depth . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
2.7.3 RNA composition . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12
2.7.4 GC content . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
2.7.5 Gene length . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13
2.7.6 Model-based normalization, not transformation . . . . . . . . . . . . 13
2.7.7 Pseudo-counts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
2.8 Negative binomial models . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
2.8.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
2.8.2 Biological coefficient of variation (BCV) . . . . . . . . . . . . . . . . 15
2.8.3 Estimating BCVs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
2.8.4 Quasi negative binomial . . . . . . . . . . . . . . . . . . . . . . . . . 17
2.9 Pairwise comparisons between two or more groups (classic) . . . . . . . . . . 17
2.9.1 Estimating dispersions . . . . . . . . . . . . . . . . . . . . . . . . . . 17
2.9.2 Testing for DE genes . . . . . . . . . . . . . . . . . . . . . . . . . . . 18
2.10 More complex experiments (glm functionality) . . . . . . . . . . . . . . . . . 19
2.10.1 Generalized linear models . . . . . . . . . . . . . . . . . . . . . . . . 19

1
2.10.2 Estimating dispersions . . . . . . . . . . . . . . . . . . . . . . . . . . 19
2.10.3 Testing for DE genes . . . . . . . . . . . . . . . . . . . . . . . . . . . 20
2.11 What to do if you have no replicates . . . . . . . . . . . . . . . . . . . . . . 21
2.12 Differential expression above a fold-change threshold . . . . . . . . . . . . . 23
2.13 Gene ontology (GO) and pathway analysis . . . . . . . . . . . . . . . . . . . 24
2.14 Gene set testing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
2.15 Clustering, heatmaps etc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
2.16 Alternative splicing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 26
2.17 CRISPR-Cas9 and shRNA-seq screen analysis . . . . . . . . . . . . . . . . . 26

3 Specific experimental designs 28


3.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
3.2 Two or more groups . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
3.2.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 28
3.2.2 Classic approach . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29
3.2.3 GLM approach . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 30
3.2.4 Questions and contrasts . . . . . . . . . . . . . . . . . . . . . . . . . 31
3.2.5 A more traditional glm approach . . . . . . . . . . . . . . . . . . . . 32
3.2.6 An ANOVA-like test for any differences . . . . . . . . . . . . . . . . . 33
3.3 Experiments with all combinations of multiple factors . . . . . . . . . . . . . 34
3.3.1 Defining each treatment combination as a group . . . . . . . . . . . . 34
3.3.2 Nested interaction formulas . . . . . . . . . . . . . . . . . . . . . . . 36
3.3.3 Treatment effects over all times . . . . . . . . . . . . . . . . . . . . . 36
3.3.4 Interaction at any time . . . . . . . . . . . . . . . . . . . . . . . . . . 37
3.4 Additive models and blocking . . . . . . . . . . . . . . . . . . . . . . . . . . 37
3.4.1 Paired samples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 37
3.4.2 Blocking . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38
3.4.3 Batch effects . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40
3.5 Comparisons both between and within subjects . . . . . . . . . . . . . . . . 40

4 Case studies 43
4.1 RNA-Seq of oral carcinomas vs matched normal tissue . . . . . . . . . . . . 43
4.1.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
4.1.2 Reading in the data . . . . . . . . . . . . . . . . . . . . . . . . . . . . 43
4.1.3 Annotation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
4.1.4 Filtering and normalization . . . . . . . . . . . . . . . . . . . . . . . 45
4.1.5 Data exploration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46
4.1.6 The design matrix . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46
4.1.7 Estimating the dispersion . . . . . . . . . . . . . . . . . . . . . . . . 47
4.1.8 Differential expression . . . . . . . . . . . . . . . . . . . . . . . . . . 48
4.1.9 Gene ontology analysis . . . . . . . . . . . . . . . . . . . . . . . . . . 50

2
4.1.10 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
4.2 RNA-Seq of pathogen inoculated arabidopsis with batch effects . . . . . . . . 52
4.2.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52
4.2.2 RNA samples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52
4.2.3 Loading the data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52
4.2.4 Filtering and normalization . . . . . . . . . . . . . . . . . . . . . . . 53
4.2.5 Data exploration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
4.2.6 The design matrix . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54
4.2.7 Estimating the dispersion . . . . . . . . . . . . . . . . . . . . . . . . 55
4.2.8 Differential expression . . . . . . . . . . . . . . . . . . . . . . . . . . 56
4.2.9 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 58
4.3 Profiles of Yoruba HapMap individuals . . . . . . . . . . . . . . . . . . . . . 59
4.3.1 Background . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
4.3.2 Loading the data . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 59
4.3.3 Filtering and normalization . . . . . . . . . . . . . . . . . . . . . . . 61
4.3.4 Estimating the dispersion . . . . . . . . . . . . . . . . . . . . . . . . 62
4.3.5 Differential expression . . . . . . . . . . . . . . . . . . . . . . . . . . 63
4.3.6 Gene set testing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 64
4.3.7 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66
4.4 RNA-Seq profiles of mouse mammary gland . . . . . . . . . . . . . . . . . . 67
4.4.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 67
4.4.2 Read alignment and processing . . . . . . . . . . . . . . . . . . . . . 67
4.4.3 Count loading and annotation . . . . . . . . . . . . . . . . . . . . . . 68
4.4.4 Filtering and normalization . . . . . . . . . . . . . . . . . . . . . . . 69
4.4.5 Data exploration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 70
4.4.6 The design matrix . . . . . . . . . . . . . . . . . . . . . . . . . . . . 71
4.4.7 Estimating the dispersion . . . . . . . . . . . . . . . . . . . . . . . . 72
4.4.8 Differential expression . . . . . . . . . . . . . . . . . . . . . . . . . . 74
4.4.9 ANOVA-like testing . . . . . . . . . . . . . . . . . . . . . . . . . . . . 76
4.4.10 Gene ontology analysis . . . . . . . . . . . . . . . . . . . . . . . . . . 77
4.4.11 Gene set testing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79
4.4.12 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 80
4.5 Differential splicing after Pasilla knockdown . . . . . . . . . . . . . . . . . . 81
4.5.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
4.5.2 RNA-Seq samples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81
4.5.3 Read alignment and processing . . . . . . . . . . . . . . . . . . . . . 82
4.5.4 Count loading and annotation . . . . . . . . . . . . . . . . . . . . . . 83
4.5.5 Filtering and normalization . . . . . . . . . . . . . . . . . . . . . . . 84
4.5.6 Data exploration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 85
4.5.7 The design matrix . . . . . . . . . . . . . . . . . . . . . . . . . . . . 86
4.5.8 Estimating the dispersion . . . . . . . . . . . . . . . . . . . . . . . . 86

3
4.5.9 Differential expression . . . . . . . . . . . . . . . . . . . . . . . . . . 88
4.5.10 Alternative splicing . . . . . . . . . . . . . . . . . . . . . . . . . . . . 88
4.5.11 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91
4.5.12 Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91
4.6 CRISPR-Cas9 knockout screen analysis . . . . . . . . . . . . . . . . . . . . . 91
4.6.1 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 91
4.6.2 Sequence processing . . . . . . . . . . . . . . . . . . . . . . . . . . . 92
4.6.3 Filtering and data exploration . . . . . . . . . . . . . . . . . . . . . . 92
4.6.4 The design matrix and dispersion estimation . . . . . . . . . . . . . . 95
4.6.5 Differential representation analysis . . . . . . . . . . . . . . . . . . . 96
4.6.6 Gene set tests to summarize over multiple sgRNAs targeting the same
gene . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 98
4.6.7 Setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 99
4.6.8 Acknowledgements . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100

4
Chapter 1

Introduction

1.1 Scope
This guide provides an overview of the Bioconductor package edgeR for differential expres-
sion analyses of read counts arising from RNA-Seq, SAGE or similar technologies [25]. The
package can be applied to any technology that produces read counts for genomic features. Of
particular interest are summaries of short reads from massively parallel sequencing technolo-
gies such as IlluminaTM , 454 or ABI SOLiD applied to RNA-Seq, SAGE-Seq or ChIP-Seq
experiments and pooled shRNA-seq or CRISPR-Cas9 genetic screens. edgeR provides sta-
tistical routines for assessing differential expression in RNA-Seq experiments or differential
marking in ChIP-Seq experiments.
The package implements exact statistical methods for multigroup experiments developed
by Robinson and Smyth [27, 28]. It also implements statistical methods based on generalized
linear models (glms), suitable for multifactor experiments of any complexity, developed by
McCarthy et al. [17], Lund et al. [15], Chen et al. [5] and Lun et al. [14]. Sometimes we
refer to the former exact methods as classic edgeR, and the latter as glm edgeR. However
the two sets of methods are complementary and can often be combined in the course of a
data analysis. Most of the glm functions can be identified by the letters glm as part of the
function name. The glm functions can test for differential expression using either likelihood
ratio tests[17, 5] or quasi-likelihood F-tests [15, 14].
A particular feature of edgeR functionality, both classic and glm, are empirical Bayes
methods that permit the estimation of gene-specific biological variation, even for experiments
with minimal levels of biological replication.
edgeR can be applied to differential expression at the gene, exon, transcript or tag level.
In fact, read counts can be summarized by any genomic feature. edgeR analyses at the
exon level are easily extended to detect differential splicing or isoform-specific differential
expression.
This guide begins with brief overview of some of the key capabilities of package, and then
gives a number of fully worked case studies, from counts to lists of genes.

5
1.2 Citation
The edgeR package implements statistical methods from the following publications. Please
try to cite the appropriate articles when you publish results obtained using the software, as
such citation is the main means by which the authors receive credit for their work.

Robinson, MD, and Smyth, GK (2008). Small sample estimation of negative binomial dis-
persion, with applications to SAGE data. Biostatistics 9, 321332.
Proposed the idea of sharing information between genes by estimating the negative
binomial variance parameter globally across all genes. This made the use of negative
binomial models practical for RNA-Seq and SAGE experiments with small to mod-
erate numbers of replicates. Introduced the terminology dispersion for the variance
parameter. Proposed conditional maximum likelihood for estimating the dispersion,
assuming common dispersion across all genes. Developed an exact test for differential
expression appropriate for the negative binomially distributed counts. Despite the of-
ficial publication date, this was the first of the papers to be submitted and accepted
for publication.

Robinson, MD, and Smyth, GK (2007). Moderated statistical tests for assessing differences
in tag abundance. Bioinformatics 23, 28812887.
Introduced empirical Bayes moderated dispersion parameter estimation. This is a
crucial improvement on the previous idea of estimating the dispersions from a global
model, because it permits gene-specific dispersion estimation to be reliable even for
small samples. Gene-specific dispersion estimation is necessary so that genes that
behave consistently across replicates should rank more highly than genes that do not.

Robinson, MD, McCarthy, DJ, Smyth, GK (2010). edgeR: a Bioconductor package for
differential expression analysis of digital gene expression data. Bioinformatics 26, 139140.
Announcement of the edgeR software package. Introduced the terminology coefficient
of biological variation.

Robinson, MD, and Oshlack, A (2010). A scaling normalization method for differential
expression analysis of RNA-seq data. Genome Biology 11, R25.
Introduced the idea of model-based scale normalization of RNA-Seq data. Proposed
TMM normalization.

McCarthy, DJ, Chen, Y, Smyth, GK (2012). Differential expression analysis of multifactor


RNA-Seq experiments with respect to biological variation. Nucleic Acids Research 40, 4288-
4297.
Extended negative binomial differential expression methods to glms, making the meth-
ods applicable to general experiments. Introduced the use of Cox-Reid approximate

6
conditional maximum likelihood for estimating the dispersion parameters, and used
this for empirical Bayes moderation. Developed fast algorithms for fitting glms to
thousands of genes in parallel. Gives a more complete explanation of the concept of
biological coefficient of variation.

Lun, ATL, Chen, Y, and Smyth, GK (2016). Its DE-licious: a recipe for differential expres-
sion analyses of RNA-seq experiments using quasi-likelihood methods in edgeR. Methods in
Molecular Biology 1418, 391416.
This book chapter explains the glmQLFit and glmQLFTest functions, which are al-
ternatives to glmFit and glmLRT. They replace the chisquare approximation to the
likelihood ratio statistic with a quasi-likelihood F-test, resulting in more conservative
and rigorous type I error rate control.

Chen, Y, Lun, ATL, and Smyth, GK (2014). Differential expression analysis of complex
RNA-seq experiments using edgeR. In: Statistical Analysis of Next Generation Sequence
Data, Somnath Datta and Daniel S Nettleton (eds), Springer, New York.
This book chapter explains the estimateDisp function and the weighted likelihood
empirical Bayes method.

Zhou X, Lindsay H, and Robinson MD (2014). Robustly detecting differential expression in


RNA sequencing data using observation weights. Nucleic Acids Research, 42, e91.
Explains estimateGLMRobustDisp, which is designed to make the downstream tests
done by glmLRT robust to outlier observations.

Dai, Z, Sheridan, JM, Gearing, LJ, Moore, DL, Su, S, Wormald, S, Wilcox, S, OConnor, L,
Dickins, RA, Blewitt, ME and Ritchie, ME (2014). edgeR: a versatile tool for the analysis
of shRNA-seq and CRISPR-Cas9 genetic screens. F1000Research 3, 95.
This paper explains the processAmplicons function for obtaining counts from the fastq
files of shRNA-seq and CRISPR-Cas9 genetic screens and outlines a general workflow
for analyzing data from such screens.

1.3 How to get help


Most questions about edgeR will hopefully be answered by the documentation or references.
If youve run into a question that isnt addressed by the documentation, or youve found
a conflict between the documentation and what the software does, then there is an active
support community that can offer help.
The edgeR authors always appreciate receiving reports of bugs in the package functions or
in the documentation. The same goes for well-considered suggestions for improvements. All
other questions or problems concerning edgeR should be posted to the Bioconductor support

7
site https://support.bioconductor.org. Please send requests for general assistance and
advice to the support site rather than to the individual authors. Posting questions to the
Bioconductor support site has a number of advantages. First, the support site includes a
community of experienced edgeR users who can answer most common questions. Second, the
edgeR authors try hard to ensure that any user posting to Bioconductor receives assistance.
Third, the support site allows others with the same sort of questions to gain from the answers.
Users posting to the support site for the first time will find it helpful to read the posting
guide at http://www.bioconductor.org/help/support/posting-guide.
Note that each function in edgeR has its own online help page. For example, a detailed
description of the arguments and output of the exactTest function can be read by typing
?exactTest or help(exactTest) at the R prompt. If you have a question about any particular
function, reading the functions help page will often answer the question very quickly. In
any case, it is good etiquette to check the relevant help page first before posting a question
to the support site.
The authors do occasionally answer questions posted to other forums, such as SEQAn-
swers or Biostar, but it is not possible to do this on a regular basis.

1.4 Quick start


edgeR offers many variants on analyses. In general, the glm pipeline is recommended as it
offers great flexibilities. There are two testing methods under the glm framework: likelihood
ratio test and quasi-likelihood F-test. The details of these two methods are described in
Chapter 2.
A typical edgeR analysis might look like the following. Here we assume there are four
RNA-Seq libraries in two groups, and the counts are stored in a tab-delimited text file, with
gene symbols in a column called Symbol.
> x <- read.delim("TableOfCounts.txt",row.names="Symbol")
> group <- factor(c(1,1,2,2))
> y <- DGEList(counts=x,group=group)
> y <- calcNormFactors(y)
> design <- model.matrix(~group)
> y <- estimateDisp(y,design)

To perform quasi-likelihood F-tests:


> fit <- glmQLFit(y,design)
> qlf <- glmQLFTest(fit,coef=2)
> topTags(qlf)

To perform likelihood ratio tests:


> fit <- glmFit(y,design)
> lrt <- glmLRT(fit,coef=2)
> topTags(lrt)

8
Chapter 2

Overview of capabilities

2.1 Terminology
edgeR performs differential abundance analysis for pre-defined genomic features. Although
not strictly necessary, it usually desirable that these genomic features are non-overlapping.
For simplicity, we will hence-forth refer to the genomic features as genes, although they
could in principle be transcripts, exons, general genomic intervals or some other type of
feature. For ChIP-seq experiments, abundance might relate to transcription factor binding
or to histone mark occupancy, but we will henceforth refer to abundance as in terms of
gene expression. In other words, the remainder of this guide will use terminology as for
a gene-level analysis of an RNA-seq experiment, although the methodology is more widely
applicable than that.

2.2 Aligning reads to a genome


The first step in an RNA-seq analysis is usually to align the raw sequence reads to a reference
genome, although there are many variations on this process. Alignment needs to allow for
the fact that reads may span multiple exons which may align to well separated locations on
the genome. We find the subread-featureCounts pipeline [11, 12] to be very fast and effective
for this purpose, but the Bowtie-TopHat-htseq pipeline is also very popular [1].

2.3 Producing a table of read counts


edgeR works on a table of integer read counts, with rows corresponding to genes and columns
to independent libraries. The counts represent the total number of reads aligning to each
gene (or other genomic locus).
Such counts can be produced from aligned reads by a variety of short read software tools.
We find the featureCounts function of the Rsubread package [12] to be particularly effective

9
and convenient, but other tools are available such as findOverlaps in the GenomicRanges
package or the Python software htseq-counts.
Reads can be counted in a number of ways. When conducting gene-level analyses, the
counts could be for reads mapping anywhere in the genomic span of the gene or the counts
could be for exons only. We usually count reads that overlap any exon for the given gene,
including the UTR as part of the first exon [12].
For data from pooled shRNA-seq or CRISPR-Cas9 genetic screens, the processAmplicons
function [7] can be used to obtain counts directly from fastq files.
Note that edgeR is designed to work with actual read counts. We not recommend that
predicted transcript abundances are input the edgeR in place of actual counts.

2.4 Reading the counts from a file


If the table of counts has been written to a file, then the first step in any analysis will usually
be to read these counts into an R session.
If the count data is contained in a single tab-delimited or comma-separated text file with
multiple columns, one for each sample, then the simplest method is usually to read the file
into R using one of the standard R read functions such as read.delim. See the quick start
above, or the case study on LNCaP Cells, or the case study on oral carcinomas later in this
guide for examples.
If the counts for different samples are stored in separate files, then the files have to be
read separately and collated together. The edgeR function readDGE is provided to do this.
Files need to contain two columns, one for the counts and one for a gene identifier.

2.5 The DGEList data class


edgeR stores data in a simple list-based data object called a DGEList. This type of object is
easy to use because it can be manipulated like any list in R. The function readDGE makes a
DGEList object directly. If the table of counts is already available as a matrix or a data.frame,
x say, then a DGEList object can be made by

> y <- DGEList(counts=x)

A grouping factor can be added at the same time:


> group <- c(1,1,2,2)
> y <- DGEList(counts=x, group=group)

The main components of an DGEList object are a matrix counts containing the integer
counts, a data.frame samples containing information about the samples or libraries, and a
optional data.frame genes containing annotation for the genes or genomic features. The
data.frame samples contains a column lib.size for the library size or sequencing depth for

10
each sample. If not specified by the user, the library sizes will be computed from the column
sums of the counts. For classic edgeR the data.frame samples must also contain a column
group, identifying the group membership of each sample.

2.6 Filtering
Genes with very low counts across all libraries provide little evidence for differential expres-
sion. In the biological point of view, a gene must be expressed at some minimal level before
it is likely to be translated into a protein or to be biologically important. In addition, the
pronounced discreteness of these counts interferes with some of the statistical approxima-
tions that are used later in the pipeline. These genes should be filtered out prior to further
analysis.
As a rule of thumb, genes are dropped if they cant possibly be expressed in all the samples
for any of the conditions. Users can set their own definition of genes being expressed. Usually
a gene is required to have a count of 5-10 in a library to be considered expressed in that
library. Users should also filter with count-per-million (CPM) rather than filtering on the
counts directly, as the latter does not account for differences in library sizes between samples.
Here is a simple example. Suppose the sample information of a DGEList object y is shown
as follows:
> y$samples

group lib.size norm.factors


Sample1 1 10880519 1
Sample2 1 9314747 1
Sample3 1 11959792 1
Sample4 2 7460595 1
Sample5 2 6714958 1

We filter out lowly expressed genes using the following commands:


> keep <- rowSums(cpm(y)>1) >= 2
> y <- y[keep, , keep.lib.sizes=FALSE]

Here, a CPM of 1 corresponds to a count of 6-7 in the smallest sample. A requirement


for expression in two or more libraries is used as the minimum number of samples in each
group is two. This ensures that a gene will be retained if it is only expressed in both samples
in group 2. It is also recommended to recalculate the library sizes of the DGEList object after
the filtering though the difference is usually negligible.

11
2.7 Normalization
2.7.1 Normalization is only necessary for sample-specific effects
edgeR is concerned with differential expression analysis rather than with the quantification
of expression levels. It is concerned with relative changes in expression levels between condi-
tions, but not directly with estimating absolute expression levels. This greatly simplifies the
technical influences that need to be taken into account, because any technical factor that
is unrelated to the experimental conditions should cancel out of any differential expression
analysis. For example, read counts can generally be expected to be proportional to length
as well as to expression for any transcript, but edgeR does not generally need to adjust for
gene length because gene length has the same relative influence on the read counts for each
RNA sample. For this reason, normalization issues arise only to the extent that technical
factors have sample-specific effects.

2.7.2 Sequencing depth


The most obvious technical factor that affects the read counts, other than gene expression
levels, is the sequencing depth of each RNA sample. edgeR adjusts any differential expression
analysis for varying sequencing depths as represented by differing library sizes. This is
part of the basic modeling procedure and flows automatically into fold-change or p-value
calculations. It is always present, and doesnt require any user intervention.

2.7.3 RNA composition


The second most important technical influence on differential expression is one that is less
obvious. RNA-seq provides a measure of the relative abundance of each gene in each RNA
sample, but does not provide any measure of the total RNA output on a per-cell basis.
This commonly becomes important when a small number of genes are very highly expressed
in one sample, but not in another. The highly expressed genes can consume a substantial
proportion of the total library size, causing the remaining genes to be under-sampled in that
sample. Unless this RNA composition effect is adjusted for, the remaining genes may falsely
appear to be down-regulated in that sample [26].
The calcNormFactors function normalizes for RNA composition by finding a set of scaling
factors for the library sizes that minimize the log-fold changes between the samples for most
genes. The default method for computing these scale factors uses a trimmed mean of M-
values (TMM) between each pair of samples [26]. We call the product of the original library
size and the scaling factor the effective library size. The effective library size replaces the
original library size in all downsteam analyses.
TMM is the recommended for most RNA-Seq data where the majority (more than half)
of the genes are believed not differentially expressed between any pair of the samples. The

12
following commands perform the TMM normalization and display the normalization factors.

> y <- calcNormFactors(y)


> y$samples

group lib.size norm.factors


Sample1 1 10880519 1.17
Sample2 1 9314747 0.86
Sample3 1 11959792 1.32
Sample4 2 7460595 0.91
Sample5 2 6714958 0.83

The normalization factors of all the libraries multiply to unity. A normalization factor
below one indicates that a small number of high count genes are monopolizing the sequencing,
causing the counts for other genes to be lower than would be usual given the library size. As
a result, the library size will be scaled down, analogous to scaling the counts upwards in that
library. Conversely, a factor above one scales up the library size, analogous to downscaling
the counts.

2.7.4 GC content
The GC-content of each gene does not change from sample to sample, so it can be expected
to have little effect on differential expression analyses to a first approximation. Recent
publications, however, have demonstrated that sample-specific effects for GC-content can
be detected [24, 9]. The EDASeq [24] and cqn [9] packages estimate correction factors that
adjust for sample-specific GC-content effects in a way that is compatible with edgeR. In each
case, the observation-specific correction factors can be input into the glm functions of edgeR
as an offset matrix.

2.7.5 Gene length


Like GC-content, gene length does not change from sample to sample, so it can be expected to
have little effect on differential expression analyses. Nevertheless, sample-specific effects for
gene length have been detected [9], although the evidence is not as strong as for GC-content.

2.7.6 Model-based normalization, not transformation


In edgeR, normalization takes the form of correction factors that enter into the statistical
model. Such correction factors are usually computed internally by edgeR functions, but it is
also possible for a user to supply them. The correction factors may take the form of scaling
factors for the library sizes, such as computed by calcNormFactors, which are then used
to compute the effective library sizes. Alternatively, gene-specific correction factors can be
entered into the glm functions of edgeR as offsets. In the latter case, the offset matrix will

13
be assumed to account for all normalization issues, including sequencing depth and RNA
composition.
Note that normalization in edgeR is model-based, and the original read counts are not
themselves transformed. This means that users should not transform the read counts in any
way before inputing them to edgeR. For example, users should not enter RPKM or FPKM
values to edgeR in place of read counts. Such quantities will prevent edgeR from correctly
estimating the mean-variance relationship in the data, which is a crucial to the statistical
strategies underlying edgeR. Similarly, users should not add artificial values to the counts
before inputing them to edgeR.
edgeR is not designed to work with estimated expression levels, for example as might be
output by Cufflinks. edgeR can work with expected counts as output by RSEM, but raw
counts are still preferred.

2.7.7 Pseudo-counts
The classic edgeR functions estimateCommonDisp and exactTest produce a matrix of pseudo-
counts as part of the output object. The pseudo-counts are used internally to speed up
computation of the conditional likelihood used for dispersion estimation and exact tests
in the classic edgeR pipeline. The pseudo-counts represent the equivalent counts would
have been observed had the library sizes all been equal, assuming the fitted model. The
pseudo-counts are computed for a specific purpose, and their computation depends on the
experimental design as well as the library sizes, so users are advised not to interpret the
psuedo-counts as general-purpose normalized counts. They are intended mainly for internal
use in the edgeR pipeline.
Disambiguation. Note that some other software packages use the term pseudo-count to
mean something analogous to prior counts in edgeR, i.e., a starting value that is added to a
zero count to avoid missing values when computing logarithms. In edgeR, a pseudo-count is
a type of normalized count and a prior count is a starting value used to offset small counts.

2.8 Negative binomial models


2.8.1 Introduction
The starting point for an RNA-Seq experiment is a set of n RNA samples, typically associated
with a variety of treatment conditions. Each sample is sequenced, short reads are mapped
to the appropriate genome, and the number of reads mapped to each genomic feature of
interest is recorded. The number of reads from sample i mapped to gene g will be denoted
ygi . The set of genewise counts for sample i makes up the expression profile or library for
that sample. The expected size of each count is the product of the library size and the
relative abundance of that gene in that sample.

14
2.8.2 Biological coefficient of variation (BCV)
RNA-Seq profiles are formed from n RNA samples. Let gi be the fraction of all cDNA
fragments in the ith sample that originate from gene g. Let G denote the total number of
genes, so G
P

g=1 gi = 1 for each sample. Let g denote the coefficient of variation (CV)
(standard deviation divided by mean) of gi between the replicates i. We denote the total
number of mapped reads in library i by Ni and the number that map to the gth gene by ygi .
Then
E(ygi ) = gi = Ni gi .
Assuming that the count ygi follows a Poisson distribution for repeated sequencing runs
of the same RNA sample, a well known formula for the variance of a mixture distribution
implies:
var(ygi ) = E [var(y|)] + var [E(y|)] = gi + g 2gi .
Dividing both sides by 2gi gives

CV2 (ygi ) = 1/gi + g .

The first term 1/gi is the squared CV for the Poisson distribution and the second is the
squared CV of the unobserved expression values. The total CV2 therefore is the technical
CV2 with which gi is measuredq
plus the biological CV2 of the true gi . In this article, we
call g the dispersion and g the biological CV although, strictly speaking, it captures
all sources of the inter-library variation between replicates, including perhaps contributions
from technical causes such as library preparation as well as true biological variation between
samples.
Two levels of variation can be distinguished in any RNA-Seq experiment. First, the
relative abundance of each gene will vary between RNA samples, due mainly to biological
causes. Second, there is measurement error, the uncertainty with which the abundance of
each gene in each sample is estimated by the sequencing technology. If aliquots of the same
RNA sample are sequenced, then the read counts for a particular gene should vary according
to a Poisson law [16]. If sequencing variation is Poisson, then it can be shown that the
squared coefficient of variation (CV) of each count between biological replicate libraries is
the sum of the squared CVs for technical and biological variation respectively,

Total CV2 = Technical CV2 + Biological CV2 .


Biological CV (BCV) is the coefficient of variation with which the (unknown) true abun-
dance of the gene varies between replicate RNA samples. It represents the CV that would
remain between biological replicates if sequencing depth could be increased indefinitely. The
technical CV decreases as the size of the counts increases. BCV on the other hand does
not. BCV is therefore likely to be the dominant source of uncertainty for high-count genes,
so reliable estimation of BCV is crucial for realistic assessment of differential expression in

15
RNA-Seq experiments. If the abundance of each gene varies between replicate RNA sam-
ples in such a way that the genewise standard deviations are proportional to the genewise
means, a commonly occurring property of measurements on physical quantities, then it is
reasonable to suppose that BCV is approximately constant across genes. We allow however
for the possibility that BCV might vary between genes and might also show a systematic
trend with respect to gene expression or expected count.
The magnitude of BCV is more important than the exact probabilistic law followed
by the true gene abundances. For mathematical convenience, we assume that the true gene
abundances follow a gamma distributional law between replicate RNA samples. This implies
that the read counts follow a negative binomial probability law.

2.8.3 Estimating BCVs


When a negative binomial model is fitted, we need to estimate the BCV(s) before we carry out
the analysis. The BCV, as shown in the previous section, is the square root of the dispersion
parameter under the negative binomial model. Hence, it is equivalent to estimating the
dispersion(s) of the negative binomial model.
The parallel nature of sequencing data allows some possibilities for borrowing information
from the ensemble of genes which can assist in inference about each gene individually. The
easiest way to share information between genes is to assume that all genes have the same
mean-variance relationship, in other words, the dispersion is the same for all the genes [28].
An extension to this common dispersion approach is to put a mean-dependent trend on a
parameter in the variance function, so that all genes with the same expected count have the
same variance.
However, the truth is that the gene expression levels have non-identical and dependent
distribution between genes, which makes the above assumptions too naive. A more general
approach that allows genewise variance functions with empirical Bayes moderation was in-
troduced several years ago [27] and was extended to generalized linear models and thus more
complex experimental designs [17]. Only when using tagwise dispersion will genes that are
consistent between replicates be ranked more highly than genes that are not. It has been
seen in many RNA-Seq datasets that allowing gene-specific dispersion is necessary in order
that differential expression is not driven by outliers. Therefore, the tagwise dispersions are
strongly recommended in model fitting and testing for differential expression.
In edgeR, we apply an empirical Bayes strategy for squeezing the tagwise dispersions
towards a global dispersion trend or towards a common dispersion value. The amount
of squeeze is determined by the weight given to the global value on one hand and the
precision of the tagwise estimates on the other. The relative weights given to the two
are determined the prior and residual degrees of freedom. By default, the prior degrees
of freedom, which determines the amount of empirical Bayes moderation, is estimated by
examining the heteroskedasticity of the data [5].

16
2.8.4 Quasi negative binomial
The NB model can be extended with quasi-likelihood (QL) methods to account for gene-
specific variability from both biological and technical sources [15, 14]. Under the QL frame-
work, the variance of the count ygi is a quadratic function of the mean,

var(ygi ) = g2 (gi + 2gi ),

where is the NB dispersion parameter and g2 is the QL dispersion parameter.


Any increase in the observed variance of ygi will be modelled by an increase in the esti-
mates for and/or g2 . In this model, the NB dispersion is a global parameter whereas the
QL is gene-specific, so the two dispersion parameters have different roles. The NB dispersion
describes the overall biological variability across all genes. It represents the observed vari-
ation that is attributable to inherent variability in the biological system, in contrast to the
Poisson variation from sequencing. The QL dispersion picks up any gene-specific variability
above and below the overall level.
The common NB dispersion for the entire data set can be used for the global parameter.
In practice, we use the trended dispersions to account for the empirical mean-variance re-
lationships. Since the NB dispersion under the QL framework reflects the overall biological
variability, it does not make sense to use the tagwise dispersions.
Estimation of the gene-specific QL dispersion is difficult as most RNA-seq data sets have
limited numbers of replicates. This means that there is often little information to stably
estimate the dispersion for each gene. To overcome this, an empirical Bayes (EB) approach
is used whereby information is shared between genes [30, 15, 21]. Briefly, a mean-dependent
trend is fitted to the raw QL dispersion estimates. The raw estimates are then squeezed
towards this trend to obtain moderated EB estimates, which can be used in place of the raw
values for downstream hypothesis testing. This EB strategy reduces the uncertainty of the
estimates and improves testing power.

2.9 Pairwise comparisons between two or more groups


(classic)
2.9.1 Estimating dispersions
edgeR uses the quantile-adjusted conditional maximum likelihood (qCML) method for ex-
periments with single factor.
Compared against several other estimators (e.g. maximum likelihood estimator, Quasi-
likelihood estimator etc.) using an extensive simulation study, qCML is the most reliable in
terms of bias on a wide range of conditions and specifically performs best in the situation
of many small samples with a common dispersion, the model which is applicable to Next-
Gen sequencing data. We have deliberately focused on very small samples due to the fact

17
that DNA sequencing costs prevent large numbers of replicates for SAGE and RNA-seq
experiments.
The qCML method calculates the likelihood by conditioning on the total counts for each
tag, and uses pseudo counts after adjusting for library sizes. Given a table of counts or a
DGEList object, the qCML common dispersion and tagwise dispersions can be estimated using
the estimateDisp() function. Alternatively, one can estimate the qCML common dispersion
using the estimateCommonDisp() function, and then the qCML tagwise dispersions using the
estimateTagwiseDisp() function.
However, the qCML method is only applicable on datasets with a single factor design
since it fails to take into account the effects from multiple factors in a more complicated
experiment. When an experiment has more than one factor involved, we need to seek a new
way of estimating dispersions.
Here is a simple example of estimating dispersions using the qCML method. Given a
DGEList object y, we estimate the dispersions using the following commands.
To estimate common dispersion and tagwise dispersions in one run (recommended):
y <- estimateDisp(y)

Alternatively, to estimate common dispersion:


y <- estimateCommonDisp(y)

Then to estimate tagwise dispersions:


y <- estimateTagwiseDisp(y)

Note that common dispersion needs to be estimated before estimating tagwise dispersions
if they are estimated separately.

2.9.2 Testing for DE genes


For all the Next-Gen squencing data analyses we consider here, people are most interested
in finding differentially expressed genes/tags between two (or more) groups. Once negative
binomial models are fitted and dispersion estimates are obtained, we can proceed with testing
procedures for determining differential expression using the exact test.
The exact test is based on the qCML methods. Knowing the conditional distribution
for the sum of counts in a group, we can compute exact p-values by summing over all sums
of counts that have a probability less than the probability under the null hypothesis of the
observed sum of counts. The exact test for the negative binomial distribution has strong
parallels with Fishers exact test.
As we dicussed in the previous section, the exact test is only applicable to experiments
with a single factor. The testing can be done by using the function exactTest(), and the
function allows both common dispersion and tagwise dispersion approaches. For example:
> et <- exactTest(y)
> topTags(et)

18
2.10 More complex experiments (glm functionality)
2.10.1 Generalized linear models
Generalized linear models (GLMs) are an extension of classical linear models to nonnormally
distributed response data [20, 19]. GLMs specify probability distributions according to their
mean-variance relationship, for example the quadratic mean-variance relationship specified
above for read counts. Assuming that an estimate is available for g , so the variance can be
evaluated for any value of gi , GLM theory can be used to fit a log-linear model

log gi = xTi g + log Ni

for each gene [13, 4]. Here xi is a vector of covariates that specifies the treatment conditions
applied to RNA sample i, and g is a vector of regression coefficients by which the covariate
effects are mediated for gene g. The quadratic variance function specifies the negative bino-
mial GLM distributional family. The use of the negative binomial distribution is equivalent
to treating the gi as gamma distributed.

2.10.2 Estimating dispersions


For general experiments (with multiple factors), edgeR uses the Cox-Reid profile-adjusted
likelihood (CR) method in estimating dispersions. The CR method is derived to overcome
the limitations of the qCML method as mentioned above. It takes care of multiple factors
by fitting generalized linear models (GLM) with a design matrix.
The CR method is based on the idea of approximate conditional likelihood which reduces
to residual maximum likelihood. Given a table counts or a DGEList object and the design
matrix of the experiment, generalized linear models are fitted. This allows valid estimation
of the dispersion, since all systematic sources of variation are accounted for.
The CR method can be used to calculate a common dispersion for all the tags, trended
dispersion depending on the tag abundance, or separate dispersions for individual tags.
These can be done by calling the function estimateDisp() with a specified design. Alter-
natively, one can estimate the common, trended and tagwise dispersions separately using
estimateGLMCommonDisp(), estimateGLMTrendedDisp() and estimateGLMTagwiseDisp(), re-
spectively. The tagwise dispersion approach is strongly recommended in multi-factor exper-
iment cases.
Here is a simple example of estimating dispersions using the GLM method. Given a
DGEList object y and a design matrix, we estimate the dispersions using the following com-
mands.
To estimate common dispersion, trended dispersions and tagwise dispersions in one run
(recommended):
y <- estimateDisp(y, design)

19
Alternatively, one can use the following calling sequence to estimate them one by one.
To estimate common dispersion:
y <- estimateGLMCommonDisp(y, design)

To estimate trended dispersions:


y <- estimateGLMTrendedDisp(y, design)

To estimate tagwise dispersions:


y <- estimateGLMTagwiseDisp(y, design)

Note that we need to estimate either common dispersion or trended dispersions prior to
the estimation of tagwise dispersions. When estimating tagwise dispersions, the empirical
Bayes method is applied to squeeze the tagwise dispersions towards a common dispersion or
towards trended dispersions, whichever exists. If both exist, the default is to use the trended
dispersions.
For more detailed examples, see the case study in section 4.1 (Tuchs data), section 4.2
(arabidopsis data), section 4.3 (Nigerian data) and section 4.4 (Fus data).

2.10.3 Testing for DE genes


For general experiments, once dispersion estimates are obtained and negative binomial mod-
els are fitted, we can proceed with testing procedures for determining differential expression
using either the generalized linear model (GLM) likelihood ratio test or the quasi-likelihood
(QL) F-test.
The GLM likelihood ratio test is based on the idea of fitting negative binomial GLMs
with the Cox-Reid dispersion estimates. The testing can be done by using the functions
glmFit() and glmLRT(). Given raw counts, dispersion(s) and a design matrix, glmFit()
fits the negative binomial GLM for each tag and produces an object of class DGEGLM with
some new components. This DGEGLM object can then be passed to glmLRT() to carry out
the likelihood ratio test. User can select one or more coefficients to drop from the full
design matrix. This gives the null model against which the full model is compared using the
likelihood ratio test. Tags can then be ranked in order of evidence for differential expression,
based on the p-value computed for each tag.
As a brief example, consider a situation in which are three treatment groups, each with
two replicates, and the researcher wants to make pairwise comparisons between them. A gen-
eralized linear model representing the study design can be fitted to the data with commands
such as:
> group <- factor(c(1,1,2,2,3,3))
> design <- model.matrix(~group)
> fit <- glmFit(y, design)

20
The fit has three parameters. The first is the baseline level of group 1. The second and third
are the 2 vs 1 and 3 vs 1 differences.
To compare 2 vs 1:
> lrt.2vs1 <- glmLRT(fit, coef=2)
> topTags(lrt.2vs1)

To compare 3 vs 1:
> lrt.3vs1 <- glmLRT(fit, coef=3)

To compare 3 vs 2:
> lrt.3vs2 <- glmLRT(fit, contrast=c(0,-1,1))

The contrast argument in this case requests a statistical test of the null hypothesis that
coefficient3coefficient2 is equal to zero.
To find genes different between any of the three groups:
> lrt <- glmLRT(fit, coef=2:3)
> topTags(lrt)

For more detailed examples, see the case study in section 4.1 (Tuchs data)
Alternatively, one can perform QL F-test to test for differential expression. While the
likelihood ratio test is a more obvious choice for inferences with GLMs, the QL F-test is
preferred as it reflects the uncertainty in estimating the dispersion for each gene. It provides
more robust and reliable error rate control when the number of replicates is small. The QL
dispersion estimation and hypothesis testing can be done by using the functions glmQLFit()
and glmQLFTest().
To apply the QL method to the above example and compare 2 vs 1:
> fit <- glmQLFit(y, design)
> qlf.2vs1 <- glmQLFTest(fit, coef=2)
> topTags(qlf.2vs1)

Similarly for the other comparisons.


For more detailed examples, see the case study in section 4.2 (arabidopsis data), sec-
tion 4.3 (Nigerian data) and section 4.4 (Fus data).

2.11 What to do if you have no replicates


edgeR is primarily intended for use with data including biological replication. Nevertheless,
RNA-Seq and ChIP-Seq are still expensive technologies, so it sometimes happens that only
one library can be created for each treatment condition. In these cases there are no replicate
libraries from which to estimate biological variability. In this situation, the data analyst
is faced with the following choices, none of which are ideal. We do not recommend any of

21
these choices as a satisfactory alternative for biological replication. Rather, they are the best
that can be done at the analysis stage, and options 24 may be better than assuming that
biological variability is absent.

1. Be satisfied with a descriptive analysis, that might include an MDS plot and an analysis
of fold changes. Do not attempt a significance analysis. This may be the best advice.
2. Simply pick a reasonable dispersion value, based on your experience with similar data,
and use that for exactTest or glmFit. Typical values for the common BCV (square-
root-dispersion) for datasets arising from well-controlled experiments are 0.4 for human
data, 0.1 for data on genetically identical model organisms or 0.01 for technical repli-
cates. Here is a toy example with simulated data:
> bcv <- 0.2
> counts <- matrix( rnbinom(40,size=1/bcv^2,mu=10), 20,2)
> y <- DGEList(counts=counts, group=1:2)
> et <- exactTest(y, dispersion=bcv^2)

Note that the p-values obtained and the number of significant genes will be very sen-
sitive to the dispersion value chosen, and be aware that less well controlled datasets,
with unaccounted-for batch effects and so on, could have in reality much larger disper-
sions than are suggested here. Nevertheless, choosing a nominal dispersion value may
be more realistic than ignoring biological variation entirely.
3. Remove one or more explanatory factors from the linear model in order to create
some residual degrees of freedom. Ideally, this means removing the factors that are
least important but, if there is only one factor and only two groups, this may mean
removing the entire design matrix or reducing it to a single column for the intercept.
If your experiment has several explanatory factors, you could remove the factor with
smallest fold changes. If your experiment has several treatment conditions, you could
try treating the two most similar conditions as replicates. Estimate the dispersion from
this reduced model, then insert these dispersions into the data object containing the
full design matrix, then proceed to model fitting and testing with glmFit and glmLRT.
This approach will only be successful if the number of DE genes is relatively small.
In conjunction with this reduced design matrix, you could try estimateGLMCommonDisp
with method="deviance", robust=TRUE and subset=NULL. This is our current best at-
tempt at an automatic method to estimate dispersion without replicates, although it
will only give good results when the counts are not too small and the DE genes are a
small proportion of the whole. Please understand that this is only our best attempt
to return something useable. Reliable estimation of dispersion generally requires repli-
cates.
4. If there exist a sizeable number of control transcripts that should not be DE, then the
dispersion could be estimated from them. For example, suppose that housekeeping is

22
an index variable identifying housekeeping genes that do not respond to the treatment
used in the experiment. First create a copy of the data object with only one treatment
group:
> y1 <- y
> y1$samples$group <- 1

Then estimate the dispersion from the housekeeping genes and all the libraries as one
group:
> y0 <- estimateCommonDisp(y1[housekeeping,])

Then insert this into the full data object and proceed:
> y$common.dispersion <- y0$common.dispersion
> et <- exactTest(y)

and so on. A reasonably large number of control transcripts is required, at least a few
dozen and ideally hundreds.

2.12 Differential expression above a fold-change thresh-


old
All the above testing methods identify differential expression based on statistical significance
regardless of how small the difference might be. On the other hand, one might be more in-
terested in studying genes of which the expression levels change by a certain amount. A
commonly used approach is to conduct DE tests, apply a fold-change cut-off and then rank
all the genes above that fold-change threshold by p-value. In some other cases genes are first
chosen according to a p-value cut-off and then sorted by their fold-changes. These combina-
tions of p-value and fold-change threshold criteria seem to give more biological meaningful
sets of genes than using either of them alone. However, they are both ad hoc and do not give
meaningful p-values for testing differential expressions relative to a fold-change threshold.
They favour lowly expressed but highly variable genes and destroy the control of FDR in
general.
edgeR offers a rigorous statistical test for thresholded hypotheses under the GLM frame-
work. It is analogous to TREAT [18] but much more powerful than the original TREAT
method. Given a fold-change (or log-fold-change) threshold, the thresholded testing can be
done by calling the function glmTreat() on a DGEGLM object produced by either glmFit() or
glmQLFit().
In the example shown in section 2.10.3, suppose we are detecting genes of which the
log2-fold-changes for 1 vs 2 are significantly greater than 1, i.e., fold-changes significantly
greater than 2, we use the following commands:

23
> fit <- glmFit(y, design)
> tr <- glmTreat(fit, coef=2, lfc=1)
> topTags(tr)

Note that the fold-change threshold in glmTreat() is not the minimum value of the fold-
change expected to see from the testing results. Genes will need to exceed this threshold by
some way before being declared statistically significant. It is better to interpret the threshold
as the fold-change below which we are definitely not interested in the gene rather than the
fold-change above which we are interested in the gene. In the presence of a huge number of
DE genes, a relatively large fold-change threshold may be appropriate to narrow down the
search to genes of interest. In the lack of DE genes, on the other hand, a small or even no
fold-change threshold shall be used.
For more detailed examples, see the case study in section 4.4 (Fus data).

2.13 Gene ontology (GO) and pathway analysis


The gene ontology (GO) enrichment analysis and the KEGG pathway enrichment analysis
are the common downstream procedures to interpret the differential expression results in
a biological context. Given a set of genes that are up- or down-regulated under a certain
contrast of interest, a GO (or pathway) enrichment analysis will find which GO terms (or
pathways) are over- or under-represented using annotations for the genes in that set.
The GO analysis can be performed using the goana() function in edgeR. The KEGG
pathway analysis can be performed using the kegga() function in edgeR. Both goana()
and kegga() take a DGELRT or DGEExact object. They both use the NCBI RefSeq annotation.
Therefore, the Entrez Gene identifier (ID) should be supplied for each gene as the row names
of the input object. Also users should set species according to the organism being studied.
The top set of most enriched GO terms can be viewed with the topGO() function, and the
top set of most enriched KEGG pathways can be viewed with the topKEGG() function.
Suppose we want to identify GO terms and KEGG pathways that are over-represented
in group 2 compared to group 1 from the previous example in section 2.10.3 assuming the
samples are collected from mice. We use the following commands:
> qlf <- glmQLFTest(fit, coef=2)
> go <- goana(qlf, species="Mm")
> topGO(go, sort="up")
> keg <- kegga(qlf, species="Mm")
> topKEGG(keg, sort="up")

For more detailed examples, see the case study in section 4.1 (Tuchs data) and section 4.4
(Fus data).

24
2.14 Gene set testing
In addition to the GO and pathway analysis, edgeR offers different types of gene set tests
for RNA-Seq data. These gene set tests are the extensions of the original gene set tests in
limma in order to handle DGEList objects.
The roast() function performs ROAST gene set tests [33]. It is a self-contained gene set
test. Given a gene set, it tests whether the majority of the genes in the set are DE across
the comparison of interest.
The mroast() function does ROAST tests for multiple sets, including adjustment for
multiple testing.
The fry() function is a fast version of mroast(). It assumes all the genes in a set have
equal variances. Since edgeR uses the z-score equivalents of NB random deviates for the gene
set tests, the above assumption is always met. Hence, fry() is recommended over roast()
and mroast() in edgeR. It gives the same result as mroast() with an infinite number of
rotations.
The camera() function performs a competitive gene set test accounting for inter-gene
correlation. It tests whether a set of genes is highly ranked relative to other genes in terms
of differential expression [34].
The romer() function performs a gene set enrichment analysis. It implements a GSEA
approach [31] based on rotation instead of permutation.
Unlike goana() and kegga(), the gene set tests are not limited to GO terms or KEGG
pathways. Any pre-defined gene set can be used, for example MSigDB gene sets. A common
application is to use a set of DE genes that was defined from an analysis of an independent
data set.
For more detailed examples, see the case study in section 4.3 (Nigerians data) and
section 4.4 (Fus data).

2.15 Clustering, heatmaps etc


The function plotMDS draws a multi-dimensional scaling plot of the RNA samples in which
distances correspond to leading log-fold-changes between each pair of RNA samples. The
leading log-fold-change is the average (root-mean-square) of the largest absolute log-fold-
changes between each pair of samples. This plot can be viewed as a type of unsupervised
clustering. The function also provides the option of computing distances in terms of BCV
between each pair of samples instead of leading logFC.
Inputing RNA-seq counts to clustering or heatmap routines designed for microarray data
is not straight-forward, and the best way to do this is still a matter of research. To draw a
heatmap of individual RNA-seq samples, we suggest using moderated log-counts-per-million.
This can be calculated by cpm with positive values for prior.count, for example
> logcpm <- cpm(y, prior.count=2, log=TRUE)

25
where y is the normalized DGEList object. This produces a matrix of log2 counts-per-million
(logCPM), with undefined values avoided and the poorly defined log-fold-changes for low
counts shrunk towards zero. Larger values for prior.count produce stronger moderation of
the values for low counts and more shrinkage of the corresponding log-fold-changes. The
logCPM values can optionally be converted to RPKM or FPKM by subtracting log2 of gene
length, see rpkm().

2.16 Alternative splicing


edgeR can also be used to analyze RNA-Seq data at the exon level to detect differential
splicing or isoform-specific differential expression. Alternative splicing events are detected
by testing for differential exon usage for each gene, that is testing whether the log-fold-
changes differ between exons for the same gene.
Both exon-level and gene-level tests can be performed simultaneously using the diffSpliceDGE()
function in edgeR. The exon-level test tests for the significant difference between the exons
logFC and the overall logFC for the gene. Two testing methods at the gene-level are pro-
vided. The first is to conduct a gene-level statistical test using the exon-level test statistics.
Whether it is a likelihood ratio test or a QL F-test depends on the pipeline chosen. The
second is to convert the exon-level p-values into a genewise p-value by the Simes method.
The first method is likely to be powerful for genes in which several exons are differentially
spliced. The Simes method is likely to be more powerful when only a minority of the exons
for a gene are differentially spliced.
The top set of most significant spliced genes can be viewed by the topSpliceDGE()
function. The exon-level testing results for a gene of interest can be visualized by the
plotSpliceDGE() function.
For more detailed examples, see the case study in section 4.5 (Pasillas data).

2.17 CRISPR-Cas9 and shRNA-seq screen analysis


edgeR can also be used to analyze data from CRISPR-Cas9 and shRNA-seq genetic screens
as described in Dai et al. (2014) [7]. Screens of this kind typically involve the comparison of
two or more cell populations either in the presence or absence of a selective pressure, or as a
time-course before and after a selective pressure is applied. The goal is to identify sgRNAs
(or shRNAs) whose representation changes (either increases or decreases) suggesting that
disrupting the target genes function has an effect on the cell.
To begin, the processAmplicons function can be used to obtain counts for each sgRNA
(or shRNA) in the screen in each sample and organise them in a DGEList for down-stream
analysis using either the classic edgeR or GLM pipeline mentioned above. Next, gene set
testing methods such as camera and roast can be used to summarize results from multiple
sgRNAs or shRNAs targeting the same gene to obtain gene-level results.

26
For a detailed example, see the case study in section 4.6 (CRISPR-Cas9 knockout screen
analysis).

27
Chapter 3

Specific experimental designs

3.1 Introduction
In this chapter, we outline the principles for setting up the design matrix and forming
contrasts for some typical experimental designs.

3.2 Two or more groups


3.2.1 Introduction
The simplest and most common type of experimental design is that in which a number
of experimental conditions are compared on the basis of independent biological replicates
of each condition. Suppose that there are three experimental conditions to be compared,
treatments A, B and C, say. The samples component of the DGEList data object might look
like:
> y$samples
group lib.size norm.factors
sample.1 A 100001 1
sample.2 A 100002 1
sample.3 B 100003 1
sample.4 B 100004 1
sample.5 C 100005 1

Note that it is not necessary to have multiple replicates for all the conditions, although it
is usually desirable to do so. By default, the conditions will be listed in alphabetical order,
regardless of the order that the data were read:
> levels(y$samples$group)
[1] "A" "B" "C"

28
3.2.2 Classic approach
The classic edgeR approach is to make pairwise comparisons between the groups. For ex-
ample,
> et <- exactTest(y, pair=c("A","B"))
> topTags(et)

will find genes differentially expressed (DE) in B vs A. Similarly


> et <- exactTest(y, pair=c("A","C"))

for C vs A, or
> et <- exactTest(y, pair=c("C","B"))

for B vs C.
Alternatively, the conditions to be compared can be specified by number, so that
> et <- exactTest(y, pair=c(3,2))

is equivalent to pair=c("C","B"), given that the second and third levels of group are B and
C respectively.
Note that the levels of group are in alphabetical order by default, but can be easily
changed. Suppose for example that C is a control or reference level to which conditions A
and B are to be compared. Then one might redefine the group levels, in a new data object,
so that C is the first level:
> y2 <- y
> y2$samples$group <- relevel(y2$samples$group, ref="C")
> levels(y2$samples$group)
[1] "C" "A" "B"

Now
> et <- exactTest(y2, pair=c("A","B"))

would still compare B to A, but


> et <- exactTest(y2, pair=c(1,2))

would now compare A to C.


When pair is not specified, the default is to compare the first two group levels, so
> et <- exactTest(y)

compares B to A, whereas
> et <- exactTest(y2)

compares A to C.

29
3.2.3 GLM approach
The glm approach to multiple groups is similar to the classic approach, but permits more
general comparisons to be made. The glm approach requires a design matrix to describe the
treatment conditions. We will usually use the model.matrix function to construct the design
matrix, although it could be constructed manually. There are always many equivalent ways
to define this matrix. Perhaps the simplest way is to define a coefficient for the expression
level of each group:
> design <- model.matrix(~0+group, data=y$samples)
> colnames(design) <- levels(y$samples$group)
> design
A B C
sample.1 1 0 0
sample.2 1 0 0
sample.3 0 1 0
sample.4 0 1 0
sample.5 0 0 1

Here, the 0+ in the model formula is an instruction not to include an intercept column and
instead to include a column for each group.
One can compare any of the treatment groups using the contrast argument of the glmLRT
function. For example,
> fit <- glmFit(y, design)
> lrt <- glmLRT(fit, contrast=c(-1,1,0))
> topTags(lrt)

will compare B to A. The meaning of the contrast is to make the comparison -1*A + 1*B +
0*C, which is of course is simply B-A.
The contrast vector can be constructed using makeContrasts if that is convenient. The
above comparison could have been made by
> BvsA <- makeContrasts(B-A, levels=design)
> lrt <- glmLRT(fit, contrast=BvsA)

One could make three pairwise comparisons between the groups by


> my.contrasts <- makeContrasts(BvsA=B-A, CvsB=C-B, CvsA=A-C, levels=design)
> lrt.BvsA <- glmLRT(fit, contrast=my.contrasts[,"BvsA"])
> topTags(lrt.BvsA)
> lrt.CvsB <- glmLRT(fit, contrast=my.contrasts[,"CvsB"])
> topTags(lrt.CvsB)
> lrt.CvsA <- glmLRT(fit, contrast=my.contrasts[,"CvsA"])
> topTags(lrt.CvsA)

which would compare B to A, C to B and C to A respectively.


Any comparison can be made. For example,

30
> lrt <- glmLRT(fit, contrast=c(-0.5,-0.5,1))

would compare C to the average of A and B. Alternatively, this same contrast could have
been specified by
> my.contrast <- makeContrasts(C-(A+B)/2, levels=design)
> lrt <- glmLRT(fit, contrast=my.contrast)

with the same results.

3.2.4 Questions and contrasts


The glm approach allows an infinite variety of contrasts to be tested between the groups.
This embarassment of riches leads to the question, which specific contrasts should we test?
This answer is that we should form and test those contrasts that correspond to the scientific
questions that we want to answer. Each statistical test is an answer to a particular question,
and we should make sure that our questions and answers match up.
To clarify this a little, we will consider a hypothetical experiment with four groups. The
groups correspond to four different types of cells: white and smooth, white and furry, red
and smooth and red furry. We will think of white and red as being the major group, and
smooth and furry as being a sub-grouping. Suppose the RNA samples look like this:
Sample Color Type Group
1 White Smooth A
2 White Smooth A
3 White Furry B
4 White Furry B
5 Red Smooth C
6 Red Smooth C
7 Red Furry D
8 Red Furry D

To decide which contrasts should be made between the four groups, we need to be clear
what are our scientific hypotheses. In other words, what are we seeking to show?
First, suppose that we wish to find genes that are always higher in red cells than in white
cells. Then we will need to form the four contrasts C-A, C-B, D-A and D-B, and select genes
that are significantly up for all four contrasts.
Or suppose we wish to establish that the difference between Red and White is large
compared to the differences between Furry and Smooth. An efficient way to establish this
would be to form the three contrasts B-A, D-C and (C+D)/2-(A+B)/2. We could confidently
make this assertion for genes for which the third contrast is far more significant than the
first two. Even if B-A and D-C are statistically significant, we could still look for genes for
which the fold changes for (C+D)/2-(A+B)/2 are much larger than those for B-A or D-C.

31
We might want to find genes that are more highly expressed in Furry cells regardless of
color. Then we would test the contrasts B-A and D-C, and look for genes that are significantly
up for both contrasts.
Or we want to assert that the difference between Furry over Smooth is much the same
regardless of color. In that case you need to show that the contrast (B+D)/2-(A+C)/2 (the
average Furry effect) is significant for many genes but that (D-C)-(B-A) (the interaction) is
not.

3.2.5 A more traditional glm approach


A more traditional way to create a design matrix in R is to include an intercept term that
represents the first level of the factor. We included 0+ in our model formula above. Had we
omitted it, the design matrix would have had the same number of columns as above, but the
first column would be the intercept term and the meanings of the second and third columns
would change:
> design <- model.matrix(~group, data=y$samples)
> design
(Intercept) groupB groupC
sample.1 1 0 0
sample.2 1 0 0
sample.3 1 1 0
sample.4 1 1 0
sample.5 1 0 1

Now the first coefficient will measure the baseline logCPM expression level in the first treat-
ment condition (here group A), and the second and third columns are relative to the baseline.
Here the second and third coefficients represent B vs A and C vs A respectively. In other
words, coef=2 now means B-A and coef=3 means C-A, so
> fit <- glmFit(y, design)
> lrt <- glmLRT(fit, coef=2)

would test for differential expression in B vs A. and


> lrt <- glmLRT(fit, coef=3)

would test for differential expression in C vs A.


This parametrization makes good sense when the first group represents a reference or
control group, as all comparison are made with respect to this condition. If we releveled the
factor to make level C the first level (see Section 3.2.2), then the design matrix becomes:
> design2 <- model.matrix(~group, data=y2$samples)
> design2
(Intercept) groupA groupB
sample.1 1 1 0
sample.2 1 1 0

32
sample.3 1 0 1
sample.4 1 0 1
sample.5 1 0 0

Now
> fit2 <- glmFit(y2, design2)
> lrt <- glmLRT(fit2, coef=2)

compares A to C, and
> lrt <- glmLRT(fit2, coef=3)

compares B to C. With this parametrization, one could still compare B to A using


> lrt <- glmLRT(fit2, contrast=c(0,-1,1))

Note that
> lrt <- glmLRT(fit2, coef=1)

should not be used. It would test whether the first coefficient is zero, but it is not meaningful
to compare the logCPM in group A to zero.

3.2.6 An ANOVA-like test for any differences


It might be of interest to find genes that are DE between any of the groups, without specifying
before-hand which groups might be different. This is analogous to a one-way ANOVA test.
In edgeR, this is done by specifying multiple coefficients to glmLRT, when the design matrix
includes an intercept term. For example, with fit as defined in the previous section,
> lrt <- glmLRT(fit, coef=2:3)
> topTags(lrt)

will find any genes that differ between any of the treatment conditions A, B or C. Technically,
this procedure tests whether either of the contrasts B-A or C-A are non-zero. Since at least
one of these must be non-zero when differences exist, the test will detect any differences. To
have this effect, the coef argument should specify all the coefficients except the intercept.
Note that this approach does not depend on how the group factor was defined, or how
the design matrix was formed, as long as there is an intercept column. For example
> lrt <- glmLRT(fit2, coef=2:3)

gives exactly the results, even though fit2 and fit were computed using different design
matrices. Here fit2 is as defined in the previous section.

33
3.3 Experiments with all combinations of multiple fac-
tors
3.3.1 Defining each treatment combination as a group
We now consider experiments with more than one experimental factor, but in which every
combination of experiment conditions can potentially have a unique effect. For example,
suppose that an experiment has been conducted with an active drug and a placebo, at three
times from 0 hours to 2 hours, with all samples obtained from independent subjects. The
data frame targets describes the treatment conditions applied to each sample:
> targets
Treat Time
Sample1 Placebo 0h
Sample2 Placebo 0h
Sample3 Placebo 1h
Sample4 Placebo 1h
Sample5 Placebo 2h
Sample6 Placebo 2h
Sample7 Drug 0h
Sample8 Drug 0h
Sample9 Drug 1h
Sample10 Drug 1h
Sample11 Drug 2h
Sample12 Drug 2h

As always, there are many ways to setup a design matrix. A simple, multi-purpose approach
is to combine all the experimental factors into one combined factor:
> Group <- factor(paste(targets$Treat,targets$Time,sep="."))
> cbind(targets,Group=Group)
Treat Time Group
Sample1 Placebo 0h Placebo.0h
Sample2 Placebo 0h Placebo.0h
Sample3 Placebo 1h Placebo.1h
Sample4 Placebo 1h Placebo.1h
Sample5 Placebo 2h Placebo.2h
Sample6 Placebo 2h Placebo.2h
Sample7 Drug 0h Drug.0h
Sample8 Drug 0h Drug.0h
Sample9 Drug 1h Drug.1h
Sample10 Drug 1h Drug.1h
Sample11 Drug 2h Drug.2h
Sample12 Drug 2h Drug.2h

Then we can take the same approach as in the previous section on two or more groups. Each
treatment time for each treatment drug is a group:

34
> design <- model.matrix(~0+Group)
> colnames(design) <- levels(Group)
> fit <- glmFit(y, design)

Then we can make any comparisons we wish. For example, we might wish to make the
following contrasts:
> my.contrasts <- makeContrasts(
+ Drug.1vs0 = Drug.1h-Drug.0h,
+ Drug.2vs0 = Drug.2h-Drug.0h,
+ Placebo.1vs0 = Placebo.1h-Placebo.0h,
+ Placebo.2vs0 = Placebo.2h-Placebo.0h,
+ DrugvsPlacebo.0h = Drug.0h-Placebo.0h,
+ DrugvsPlacebo.1h = (Drug.1h-Drug.0h)-(Placebo.1h-Placebo.0h),
+ DrugvsPlacebo.2h = (Drug.2h-Drug.0h)-(Placebo.2h-Placebo.0h),
+ levels=design)

To find genes responding to the drug at 1 hour:


> lrt <- glmLRT(fit, contrast=my.contrasts[,"Drug.1vs0"])

or at 2 hours:
> lrt <- glmLRT(fit, contrast=my.contrasts[,"Drug.2vs0"])

To find genes with baseline differences between the drug and the placebo at 0 hours:
> lrt <- glmLRT(fit, contrast=my.contrasts[,"DrugvsPlacebo.0h"])

To find genes that have responded differently to the drug and the placebo at 2 hours:
> lrt <- glmLRT(fit, contrast=my.contrasts[,"DrugvsPlacebo.2h"])

Of course, it is not compulsory to use makeContrasts to form the contrasts. The coeffi-
cients are the following:
> colnames(fit)
[1] "Drug.0h" "Drug.1h" "Drug.2h" "Placebo.0h" "Placebo.1h" "Placebo.2h"

so
> lrt <- glmLRT(fit, contrast=c(-1,0,1,0,0,0))

would find the Drug.2vs0 contrast, and


> lrt <- glmLRT(fit, contrast=c(-1,0,1,1,0,-1))

is another way of specifying the DrugvsPlacebo.2h contrast.

35
3.3.2 Nested interaction formulas
We generally recommend the approach of the previous section, because it is so explicit and
easy to understand. However it may be useful to be aware of more short-hand approach to
form the same contrasts in the previous section using a model formula. First, make sure
that the placebo is the reference level:
> targets$Treat <- relevel(targets$Treat, ref="Placebo")

Then form the design matrix:


> design <- model.matrix(~Treat + Treat:Time, data=targets)
> fit <- glmFit(y, design)

The meaning of this formula is to consider all the levels of time for each treatment drug
separately. The second term is a nested interaction, the interaction of Time within Treat.
The coefficient names are:
> colnames(fit)
[1] "(Intercept)" "TreatDrug"
[3] "TreatPlacebo:Time1h" "TreatDrug:Time1h"
[5] "TreatPlacebo:Time2h" "TreatDrug:Time2h"

Now most of the above contrasts are directly available as coefficients:


> lrt <- glmLRT(fit, coef=2)

is the baseline drug vs placebo comparison,


> lrt <- glmLRT(fit, coef=4)

is the drug effect at 1 hour,


> lrt <- glmLRT(fit, coef=6)

is the drug effect at 2 hours, and finally


> lrt <- glmLRT(fit, contrast=c(0,0,0,0-1,1))

is the DrugvsPlacebo.2h contrast.

3.3.3 Treatment effects over all times


The nested interaction model makes it easy to find genes that respond to the treatment at
any time, in a single test. Continuing the above example,
> lrt <- glmLRT(fit, coef=c(4,6))

finds genes that respond to the treatment at either 1 hour or 2 hours versus the 0 hour
baseline. This is analogous to an ANOVA F -test for a normal linear model.

36
3.3.4 Interaction at any time
The full interaction formula is
> design <- model.matrix(~Treat * Time, data=targets)

which is equivalent to
> design <- model.matrix(~Treat + Time + Treat:Time, data=targets)
> fit <- glmFit(y, design)

This formula is primarily useful as a way to conduct an overall test for interaction. The
coefficient names are:
> colnames(design)
[1] "(Intercept)" "TreatDrug"
[3] "Time1h" "Time2h"
[5] "TreatDrug:Time1h" "TreatDrug:Time2h"

Now
> lrt <- glmLRT(fit, coef=2)

is again the baseline drug vs placebo comparison, but


> lrt <- glmLRT(fit, coef=3)

and
> lrt <- glmLRT(fit, coef=4)

are the effects of the reference drug, i.e., the effects of the placebo at 1 hour and 2 hours.
The last two coefficients give the DrugvsPlacebo.1h and DrugvsPlacebo.2h contrasts, so that
> lrt <- glmLRT(fit, coef=5:6)

is useful because it detects genes that respond differently to the drug, relative to the placebo,
at either of the times.

3.4 Additive models and blocking


3.4.1 Paired samples
Paired samples occur whenever we compare two treatments and each independent subject
in the experiment receives both treatments. Suppose for example that an experiment is
conducted to compare a new treatment (T) with a control (C). Suppose that both the
control and the treatment are administered to each of three patients. This produces the
sample data:

37
FileName Subject Treatment
File1 1 C
File2 1 T
File3 2 C
File4 2 T
File5 3 C
File6 3 T

This is a paired design in which each subject receives both the control and the active treat-
ment. We can therefore compare the treatment to the control for each patient separately, so
that baseline differences between the patients are subtracted out.
The design matrix is formed from an additive model formula without an interaction term:
> Subject <- factor(targets$Subject)
> Treat <- factor(targets$Treatment, levels=c("C","T"))
> design <- model.matrix(~Subject+Treat)

The omission of an interaction term is characteristic of paired designs. We are not interested
in the effect of the treatment on an individual patient (which is what an interaction term
would examine). Rather we are interested in the average effect of the treatment over a
population of patients.
As always, the dispersion has to be estimated:
> y <- estimateGLMCommonDisp(y,design)
> y <- estimateGLMTrendedDisp(y,design)
> y <- estimateGLMTagwiseDisp(y,design)

We proceed to fit a linear model and test for the treatment effect. Note that we can omit
the coef argument to glmLRT because the treatment effect is the last coefficient in the model.
> fit <- glmFit(y, design)
> lrt <- glmLRT(fit)
> topTags(lrt)

This test detects genes that are differentially expressed in response to the active treatment
compared to the control, adjusting for baseline differences between the patients. This test
can be viewed as a generalization of a paired t-test.
See the oral carcinomas case study of Section 4.1 for a fully worked analysis with paired
samples.

3.4.2 Blocking
Paired samples are a simple example of what is called blocking in experimental design.
The idea of blocking is to compare treatments using experimental subjects that are as similar
as possible, so that the treatment difference stands out as clearly as possible.

38
Suppose for example that we wish to compare three treatments A, B and C using exper-
imental animals. Suppose that animals from the same litter are appreciably more similar
than animals from different litters. This might lead to an experimental setup like:
FileName Litter Treatment
File1 1 A
File2 1 B
File3 1 C
File4 2 B
File5 2 A
File6 2 C
File7 3 C
File8 3 B
File9 3 A
Here it is the differences between the treatments that are of interest. The differences between
the litters are not of primary interest, nor are we interested in a treatment effect that occurs
for in only one litter, because that would not be reproducible.
We can compare the three treatments adjusting for any baseline differences between the
litters by fitting an additive model:
> Litter <- factor(targets$Litter)
> Treatment <- factor(targets$Treatment)
> design <- model.matrix(~Litter+Treatment)

This creates a design matrix with five columns: three for the litters and two more for the
differences between the treatments.
If fit is the fitted model with this design matrix, then we may proceed as follows. To
detect genes that are differentially expressed between any of the three treatments, adjusting
for litter differences:
> lrt <- glmLRT(fit, coef=4:5)
> topTags(lrt)

To detect genes that are differentially expressed in treatment B vs treatment A:


> lrt <- glmLRT(fit, coef=4)
> topTags(lrt)

To detect genes that are differentially expressed in treatment C vs treatment A:


> lrt <- glmLRT(fit, coef=5)
> topTags(lrt)

To detect genes that are differentially expressed in treatment C vs treatment B:


> lrt <- glmLRT(fit, contrast=c(0,0,0,-1,1))
> topTags(lrt)

39
The advantage of using litter as a blocking variable in the analysis is that this will make
the comparison between the treatments more precise, if litter-mates are more alike that
animals from different litters. On the other hand, if litter-mates are no more alike than
animals from different litters, which might be so for genetically identical inbred laboratory
animals, then the above analysis is somewhat inefficient because the litter effects are being
estimated unnecessarily. In that case, it would be better to omit litter from the model
formula.

3.4.3 Batch effects


Another situation in which additive model formulas are used is when correcting for batch
effects in an experiment. The situation here is analogous to blocking, the only difference
being that the batch effects were probably unintended rather than a deliberate aspect of
the experimental design. The analysis is the same as for blocking. The treatments can be
adjusted for differences between the batches by using an additive model formula of the form:
> design <- model.matrix(~Batch+Treatment)

In this type of analysis, the treatments are compared only within each batch. The analysis
is corrected for baseline differences between the batches.
The Arabidopsis case study in Section 4.2 gives a fully worked example with batch effects.

3.5 Comparisons both between and within subjects


Here is a more complex scenario, posed by a poster to the Bioconductor mailing list. The
experiment has 18 RNA samples collected from 9 subjects. The samples correspond to cells
from 3 healthy patients, either treated or not with a hormone; cells from 3 patients with
disease 1, either treated or not with the hormone; and cells from 3 patients with disease 2,
either treated or not with the hormone. The targets frame looks like this:
> targets
Disease Patient Treatment
1 Healthy 1 None
2 Healthy 1 Hormone
3 Healthy 2 None
4 Healthy 2 Hormone
5 Healthy 3 None
6 Healthy 3 Hormone
7 Disease1 4 None
8 Disease1 4 Hormone
9 Disease1 5 None
10 Disease1 5 Hormone
11 Disease1 6 None
12 Disease1 6 Hormone
13 Disease2 7 None

40
14 Disease2 7 Hormone
15 Disease2 8 None
16 Disease2 8 Hormone
17 Disease2 9 None
18 Disease2 9 Hormone

If all the RNA samples were collected from independent subjects, then this would be nested
factorial experiment, from which we would want to estimate the treatment effect for each
disease group. As it is, however, we have a paired comparison experiment for each disease
group. The feature that makes this experiment complex is that some comparisons (between
the diseases) are made between patients while other comparisons (hormone treatment vs no
treatment) are made within patients.
The design matrix will be easier to construct in R if we re-number the patients within
each disease group:
> Patient <- gl(3,2,length=18)

We also define Disease and Treatment to be factors, with the control state as the first level
in each case:
> Disease <- factor(targets$Disease, levels=c("Healthy","Disease1","Disease2"))
> Treatment <- factor(targets$Treatment, levels=c("None","Hormone"))

This gives us a revised targets frame:


> data.frame(Disease,Patient,Treatment)
Disease Patient Treatment
1 Healthy 1 None
2 Healthy 1 Hormone
3 Healthy 2 None
4 Healthy 2 Hormone
5 Healthy 3 None
6 Healthy 3 Hormone
7 Disease1 1 None
8 Disease1 1 Hormone
9 Disease1 2 None
10 Disease1 2 Hormone
11 Disease1 3 None
12 Disease1 3 Hormone
13 Disease2 1 None
14 Disease2 1 Hormone
15 Disease2 2 None
16 Disease2 2 Hormone
17 Disease2 3 None
18 Disease2 3 Hormone

Now we can construct the design matrix. The critical feature to appreciate is that Patient
and Treatment are of interest within each disease group, so we use the nested factorial formula

41
discussed in a previous section. The patients are nested with the disease groups, because
we have different patients in each group. The treatment is nested within disease groups,
because we are interested in the disease-specific treatment effects. The model formula has
the main effect for disease plus nested interactions with Patient and Treatment:
> design <- model.matrix(~Disease+Disease:Patient+Disease:Treatment)
> colnames(design)
[1] "(Intercept)" "DiseaseDisease1"
[3] "DiseaseDisease2" "DiseaseHealthy:Patient2"
[5] "DiseaseDisease1:Patient2" "DiseaseDisease2:Patient2"
[7] "DiseaseHealthy:Patient3" "DiseaseDisease1:Patient3"
[9] "DiseaseDisease2:Patient3" "DiseaseHealthy:TreatmentHormone"
[11] "DiseaseDisease1:TreatmentHormone" "DiseaseDisease2:TreatmentHormone"

After estimating the dispersions (code not shown), we can fit a linear model:
> fit <- glmFit(y, design)

To find genes responding to the hormone in healthy patients:


> lrt <- glmLRT(fit, coef="DiseaseHealthy:TreatmentHormone")
> topTags(lrt)

To find genes responding to the hormone in disease1 patients:


> lrt <- glmLRT(fit, coef="DiseaseDisease1:TreatmentHormone")
> topTags(lrt)

To find genes responding to the hormone in disease2 patients:


> lrt <- glmLRT(fit, coef="DiseaseDisease2:TreatmentHormone")
> topTags(lrt)

To find genes that respond to the hormone in any disease group:


> lrt <- glmLRT(fit, coef=10:12)
> topTags(lrt)

To find genes that respond differently to the hormone in disease1 vs healthy patients:
> lrt <- glmLRT(fit, contrast=c(0,0,0,0,0,0,0,0,0,-1,1,0))
> topTags(lrt)

To find genes that respond differently to the hormone in disease2 vs healthy patients:
> lrt <- glmLRT(fit, contrast=c(0,0,0,0,0,0,0,0,0,-1,0,1))
> topTags(lrt)

To find genes that respond differently to the hormone in disease2 vs disease1 patients:
> lrt <- glmLRT(fit, contrast=c(0,0,0,0,0,0,0,0,0,0,-1,1))
> topTags(lrt)

42
Chapter 4

Case studies

4.1 RNA-Seq of oral carcinomas vs matched normal


tissue
4.1.1 Introduction
This section provides a detailed analysis of data from a paired design RNA-seq experiment,
featuring oral squamous cell carcinomas and matched normal tissue from three patients [32].
The aim of the analysis is to detect genes differentially expressed between tumor and normal
tissue, adjusting for any differences between the patients. This provides an example of the
GLM capabilities of edgeR.
RNA was sequenced on an Applied Biosystems SOLiD System 3.0 and reads mapped
to the UCSC hg18 reference genome [32]. Read counts, summarised at the level of refSeq
transcripts, are available in Table S1 of Tuch et al. [32].

4.1.2 Reading in the data


The read counts for the six individual libraries are stored in one tab-delimited file. To make
this file, we downloaded Table S1 from Tuch et al. [32], deleted some unnecessary columns
and edited the column headings slightly:
> rawdata <- read.delim("TableS1.txt", check.names=FALSE, stringsAsFactors=FALSE)
> head(rawdata)
RefSeqID Symbol NbrOfExons 8N 8T 33N 33T 51N 51T
1 NM_182502 TMPRSS11B 10 2592 3 7805 321 3372 9
2 NM_003280 TNNC1 6 1684 0 1787 7 4894 559
3 NM_152381 XIRP2 10 9915 15 10396 48 23309 7181
4 NM_022438 MAL 3 2496 2 3585 239 1596 7
5 NM_001100112 MYH2 40 4389 7 7944 16 9262 1818
6 NM_017534 MYH2 40 4402 7 7943 16 9244 1815

43
For easy manipulation, we put the data into a DGEList object:
> library(edgeR)
> y <- DGEList(counts=rawdata[,4:9], genes=rawdata[,1:3])

4.1.3 Annotation
The study by Tuch et al. [32] was undertaken a few years ago, so not all of the RefSeq IDs
provided by match RefSeq IDs currently in use. We retain only those transcripts with IDs
in the current NCBI annotation, which is provided by the org.HS.eg.db package:
> library(org.Hs.eg.db)
> idfound <- y$genes$RefSeqID %in% mappedRkeys(org.Hs.egREFSEQ)
> y <- y[idfound,]
> dim(y)
[1] 15554 6

We add Entrez Gene IDs to the annotation:


> egREFSEQ <- toTable(org.Hs.egREFSEQ)
> head(egREFSEQ)
gene_id accession
1 1 NM_130786
2 1 NP_570602
3 2 NM_000014
4 2 NP_000005
5 2 XM_006719056
6 2 XP_006719119
> m <- match(y$genes$RefSeqID, egREFSEQ$accession)
> y$genes$EntrezGene <- egREFSEQ$gene_id[m]

Now use the Entrez Gene IDs to update the gene symbols:
> egSYMBOL <- toTable(org.Hs.egSYMBOL)
> head(egSYMBOL)
gene_id symbol
1 1 A1BG
2 2 A2M
3 3 A2MP1
4 9 NAT1
5 10 NAT2
6 11 NATP
> m <- match(y$genes$EntrezGene, egSYMBOL$gene_id)
> y$genes$Symbol <- egSYMBOL$symbol[m]
> head(y$genes)

44
RefSeqID Symbol NbrOfExons EntrezGene
1 NM_182502 TMPRSS11B 10 132724
2 NM_003280 TNNC1 6 7134
3 NM_152381 XIRP2 10 129446
4 NM_022438 MAL 3 4118
5 NM_001100112 MYH2 40 4620
6 NM_017534 MYH2 40 4620

4.1.4 Filtering and normalization


Different RefSeq transcripts for the same gene symbol count predominantly the same reads.
So we keep one transcript for each gene symbol. We choose the transcript with highest
overall count:
> o <- order(rowSums(y$counts), decreasing=TRUE)
> y <- y[o,]
> d <- duplicated(y$genes$Symbol)
> y <- y[!d,]
> nrow(y)
[1] 10522

Normally we would also filter lowly expressed genes. For this data, all transcripts already
have at least 50 reads for all samples of at least one of the tissues types.
Recompute the library sizes:
> y$samples$lib.size <- colSums(y$counts)

Use Entrez Gene IDs as row names:


> rownames(y$counts) <- rownames(y$genes) <- y$genes$EntrezGene
> y$genes$EntrezGene <- NULL

TMM normalization is applied to this dataset to account for compositional difference


between the libraries.
> y <- calcNormFactors(y)
> y$samples
group lib.size norm.factors
8N 1 7991697 1.146
8T 1 7372864 1.086
33N 1 15759233 0.672
33T 1 14048345 0.974
51N 1 21545607 1.031
51T 1 15197597 1.191

45
4.1.5 Data exploration
The first step of an analysis should be to examine the samples for outliers and for other
relationships. The function plotMDS produces a plot in which distances between samples
correspond to leading biological coefficient of variation (BCV) between those samples:

> plotMDS(y)

2.0
51T
1.5
Leading logFC dim 2

1.0

51N
0.5
0.0

8T

8N
1.0

33T
33N

3 2 1 0 1 2

Leading logFC dim 1

In the plot, dimension 1 separates the tumor from the normal samples, while dimension 2
roughly corresponds to patient number. This confirms the paired nature of the samples. The
tumor samples appear more heterogeneous than the normal samples.

4.1.6 The design matrix


Before we fit negative binomial GLMs, we need to define our design matrix based on the
experimental design. Here we want to test for differential expression between tumour and
normal tissues within patients, i.e. adjusting for differences between patients. In statistical
terms, this is an additive linear model with patient as the blocking factor:
> Patient <- factor(c(8,8,33,33,51,51))
> Tissue <- factor(c("N","T","N","T","N","T"))
> data.frame(Sample=colnames(y),Patient,Tissue)
Sample Patient Tissue
1 8N 8 N
2 8T 8 T
3 33N 33 N

46
4 33T 33 T
5 51N 51 N
6 51T 51 T
> design <- model.matrix(~Patient+Tissue)
> rownames(design) <- colnames(y)
> design
(Intercept) Patient33 Patient51 TissueT
8N 1 0 0 0
8T 1 0 0 1
33N 1 1 0 0
33T 1 1 0 1
51N 1 0 1 0
51T 1 0 1 1
attr(,"assign")
[1] 0 1 1 2
attr(,"contrasts")
attr(,"contrasts")$Patient
[1] "contr.treatment"

attr(,"contrasts")$Tissue
[1] "contr.treatment"

This sort of additive model is appropriate for paired designs, or experiments with batch
effects.

4.1.7 Estimating the dispersion


We estimate the NB dispersion for the dataset.
> y <- estimateDisp(y, design, robust=TRUE)
> y$common.dispersion
[1] 0.159

The square root of the common dispersion gives the coefficient of variation of biological
variation. Here the common dispersion is found to be 0.159, so the coefficient of biological
variation is around 0.4.
The dispersion estimates can be viewed in a BCV plot:

> plotBCV(y)

47
4.1.8 Differential expression
Now proceed to determine differentially expressed genes. Fit genewise glms:
> fit <- glmFit(y, design)

Conduct likelihood ratio tests for tumour vs normal tissue differences and show the top
genes:
> lrt <- glmLRT(fit)
> topTags(lrt)
Coefficient: TissueT
RefSeqID Symbol NbrOfExons logFC logCPM LR PValue FDR
5737 NM_001039585 PTGFR 4 -5.18 4.74 98.7 2.98e-23 3.13e-19
5744 NM_002820 PTHLH 4 3.97 6.21 92.1 8.14e-22 4.28e-18
3479 NM_001111283 IGF1 5 -3.99 5.71 86.5 1.38e-20 4.85e-17
1288 NM_033641 COL4A6 45 3.66 5.72 77.5 1.33e-18 3.49e-15
10351 NM_007168 ABCA8 38 -3.98 4.94 75.9 2.97e-18 6.24e-15
5837 NM_005609 PYGM 20 -5.48 5.99 75.4 3.80e-18 6.67e-15
487 NM_004320 ATP2A1 23 -4.62 5.96 74.8 5.14e-18 7.72e-15
27179 NM_014440 IL36A 4 -6.17 5.40 72.2 1.97e-17 2.59e-14
196374 NM_173352 KRT78 9 -4.25 7.61 70.8 4.03e-17 4.71e-14
83699 NM_031469 SH3BGRL2 4 -3.93 5.53 67.8 1.83e-16 1.92e-13

Note that glmLRT has conducted a test for the last coefficient in the linear model, which we
can see is the tumor vs normal tissue effect:
> colnames(design)

48
[1] "(Intercept)" "Patient33" "Patient51" "TissueT"

The genewise tests are for tumor vs normal differential expression, adjusting for baseline
differences between the three patients. The tests can be viewed as analogous to paired
t-tests. The top DE tags have tiny p-values and FDR values, as well as large fold changes.
Heres a closer look at the counts-per-million in individual samples for the top genes:
> o <- order(lrt$table$PValue)
> cpm(y)[o[1:10],]
8N 8T 33N 33T 51N 51T
5737 49.69 0.874 27.08 0.877 78.11 2.5424
5744 7.32 95.817 11.79 204.075 6.88 116.2887
3479 50.24 3.123 32.36 1.901 211.62 14.2045
1288 12.12 140.166 6.32 94.396 4.86 56.8179
10351 52.64 3.123 39.44 2.120 79.19 6.0797
5837 152.80 2.748 119.55 1.170 97.69 5.6928
487 107.91 3.123 147.01 3.802 102.82 8.8985
27179 40.08 1.249 172.11 3.290 36.09 0.0553
196374 372.22 20.738 581.06 47.747 145.07 4.5322
83699 96.22 5.122 117.10 5.411 48.19 5.4165

We see that all the top genes have consistent tumour vs normal changes for the three patients.
The total number of differentially expressed genes at 5% FDR is given by:
> summary(decideTests(lrt))
TissueT
-1 939
0 9253
1 330

Plot log-fold change against log-counts per million, with DE genes highlighted:

> plotMD(lrt)
> abline(h=c(-1, 1), col="blue")

49
The blue lines indicate 2-fold changes.

4.1.9 Gene ontology analysis


We perform a gene ontology analysis focusing on the ontology of biological process (BP).
The genes up-regulated in the tumors tend to be associated with cell differentiation, cell
migration and tissue morphogenesis:
> go <- goana(lrt)
> topGO(go, ont="BP", sort="Up", n=30)
Term Ont N Up Down P.Up P.Down
GO:0040011 locomotion BP 909 69 136 7.62e-12 4.10e-10
GO:0009888 tissue development BP 1089 75 168 8.68e-11 1.34e-13
GO:0030198 extracellular matrix organization BP 232 29 44 3.27e-10 1.18e-06
GO:0043062 extracellular structure organization BP 232 29 44 3.27e-10 1.18e-06
GO:0006928 movement of cell or subcellular component BP 1077 73 162 3.48e-10 3.62e-12
GO:0030154 cell differentiation BP 2062 113 263 7.84e-10 4.34e-11
GO:0048699 generation of neurons BP 764 57 87 1.43e-09 1.02e-02
GO:0022008 neurogenesis BP 819 59 93 2.66e-09 8.61e-03
GO:0016477 cell migration BP 767 56 121 4.51e-09 1.56e-10
GO:0048870 cell motility BP 816 58 124 6.14e-09 1.04e-09
GO:0051674 localization of cell BP 816 58 124 6.14e-09 1.04e-09
GO:0048869 cellular developmental process BP 2294 118 277 1.37e-08 4.54e-09
GO:0007275 multicellular organism development BP 2761 134 331 3.18e-08 9.87e-11
GO:0044707 single-multicellular organism process BP 3325 154 406 3.19e-08 1.98e-15
GO:0032502 developmental process BP 3348 153 384 9.92e-08 4.77e-10
GO:0048731 system development BP 2456 121 310 1.07e-07 8.76e-13
GO:0048856 anatomical structure development BP 3107 144 374 1.42e-07 8.41e-13

50
GO:0007155 cell adhesion BP 1077 66 152 1.61e-07 2.38e-09
GO:0022610 biological adhesion BP 1081 66 153 1.85e-07 1.70e-09
GO:0060429 epithelium development BP 660 47 82 2.01e-07 1.22e-03
GO:0009653 anatomical structure morphogenesis BP 1577 86 215 2.66e-07 1.10e-11
GO:0043588 skin development BP 163 20 21 2.73e-07 5.67e-02
GO:0030182 neuron differentiation BP 691 48 80 3.09e-07 9.07e-03
GO:0048729 tissue morphogenesis BP 407 34 51 3.20e-07 8.37e-03
GO:0048513 animal organ development BP 1825 95 242 4.45e-07 6.54e-12
GO:0048598 embryonic morphogenesis BP 340 30 38 5.22e-07 8.94e-02
GO:0044767 single-organism developmental process BP 3285 148 377 5.40e-07 7.60e-10
GO:0032501 multicellular organismal process BP 3562 157 457 7.36e-07 2.62e-23
GO:0007399 nervous system development BP 1197 69 132 8.09e-07 5.18e-03
GO:0008544 epidermis development BP 192 21 28 9.54e-07 6.69e-03

4.1.10 Setup
This analysis was conducted on:
> sessionInfo()
R version 3.3.3 (2017-03-06)
Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 7 x64 (build 7601) Service Pack 1

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC_MONETARY=English_Australia.1252 LC_NUMERIC=C
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] parallel stats4 stats graphics grDevices utils datasets methods base

other attached packages:


[1] GO.db_3.4.0 org.Mm.eg.db_3.4.0 tweeDEseqCountData_1.12.0
[4] NBPSeq_0.3.0 org.Hs.eg.db_3.4.0 AnnotationDbi_1.36.2
[7] IRanges_2.8.2 S4Vectors_0.12.2 Biobase_2.34.0
[10] BiocGenerics_0.20.0 edgeR_3.17.9 limma_3.30.13

loaded via a namespace (and not attached):


[1] Rcpp_0.12.10 magrittr_1.5 splines_3.3.3 munsell_0.4.3 statmod_1.4.29
[6] colorspace_1.3-2 lattice_0.20-34 stringr_1.2.0 plyr_1.8.4 tools_3.3.3
[11] grid_3.3.3 gtable_0.2.0 DBI_0.6 assertthat_0.1 lazyeval_0.2.0
[16] digest_0.6.12 tibble_1.2 reshape2_1.4.2 ggplot2_2.2.1 memoise_1.0.0
[21] qvalue_2.6.0 RSQLite_1.1-2 stringi_1.1.2 scales_0.4.1 locfit_1.5-9.1

51
4.2 RNA-Seq of pathogen inoculated arabidopsis with
batch effects
4.2.1 Introduction
This case study re-analyses Arabidopsis thaliana RNA-Seq data described by Cumbie et
al. [6]. Summarized count data is available as a data object in the CRAN package NBPSeq
comparing hrcC challenged and mock-inoculated samples [6]. Samples were collected in
three batches, and adjustment for batch effects proves to be important. The aim of the
analysis therefore is to detect genes differentially expressed in response to hrcC challenge,
while correcting for any differences between the batches.

4.2.2 RNA samples


Pseudomonas syringae is a bacterium often used to study plant reactions to pathogens. In
this experiment, six-week old Arabidopsis plants were inoculated with the hrcC mutant of
P. syringae, after which total RNA was extracted from leaves. Control plants were inoculated
with a mock pathogen.
Three biological replicates of the experiment were conducted at separate times and using
independently grown plants and bacteria.
The six RNA samples were sequenced one per lane on an Illumina Genome Analyzer.
Reads were aligned and summarized per gene using GENE-counter. The reference genome
was derived from the TAIR9 genome release (www.arabidopsis.org).

4.2.3 Loading the data


Load the data from the NBPSeq package:
> library(NBPSeq)
> library(edgeR)
> data(arab)
> head(arab)
mock1 mock2 mock3 hrcc1 hrcc2 hrcc3
AT1G01010 35 77 40 46 64 60
AT1G01020 43 45 32 43 39 49
AT1G01030 16 24 26 27 35 20
AT1G01040 72 43 64 66 25 90
AT1G01050 49 78 90 67 45 60
AT1G01060 0 15 2 0 21 8

There are two experimental factors, treatment (hrcc vs mock) and the time that each replicate
was conducted:

52
> Treat <- factor(substring(colnames(arab),1,4))
> Treat <- relevel(Treat, ref="mock")
> Time <- factor(substring(colnames(arab),5,5))

We then create a DGEList object:


> y <- DGEList(counts=arab, group=Treat)

4.2.4 Filtering and normalization


There is no purpose in analysing genes that are not expressed in either experimental condi-
tion. We consider a gene to be expressed at a reasonable level in a sample if it has at least
two counts for each million mapped reads in that sample. This cutoff is ad hoc, but serves
to require at least 46 reads in this case. Since this experiment has three replicates for each
condition, a gene should be expressed in at least three samples if it responds to at least one
condition. Hence we keep genes with at least two counts per million (CPM) in at least three
samples:
> keep <- rowSums(cpm(y)>2) >= 3
> table(keep)
keep
FALSE TRUE
9696 16526
> y <- y[keep, , keep.lib.sizes=FALSE]

Note that the filtering does not use knowledge of what treatment corresponds to each sample,
so the filtering does not bias the subsequent differential expression analysis.
The TMM normalization is applied to account for the compositional biases:
> y <- calcNormFactors(y)
> y$samples
group lib.size norm.factors
mock1 mock 1896802 0.979
mock2 mock 1898690 1.054
mock3 mock 3249396 0.903
hrcc1 hrcc 2119367 1.051
hrcc2 hrcc 1264927 1.096
hrcc3 hrcc 3516253 0.932

4.2.5 Data exploration


An MDS plot shows the relative similarities of the six samples.

> plotMDS(y)

53
mock2

1.5
1.0
Leading logFC dim 2
mock1

0.5
mock3

0.0
0.5

hrcc2 hrcc1
1.0

hrcc3

2 1 0 1

Leading logFC dim 1

Distances on an MDS plot of a DGEList object correspond to leading log-fold-change between


each pair of samples. Leading log-fold-change is the root-mean-square average of the largest
log2 -fold-changes between each pair of samples. Each pair of samples extracted at each time
tend to cluster together, suggesting a batch effect. The hrcc treated samples tend to be
below the mock samples for each time, suggesting a treatment effect within each time. The
two samples at time 1 are less consistent than at times 2 and 3.
To examine further consistency of the three replicates, we compute predictive log2-fold-
changes (logFC) for the treatment separately for the three times.
> design <- model.matrix(~Time+Time:Treat)
> logFC <- predFC(y,design,prior.count=1,dispersion=0.05)
The logFC at the three times are positively correlated with one another, as we would hope:
> cor(logFC[,4:6])
Time1:Treathrcc Time2:Treathrcc Time3:Treathrcc
Time1:Treathrcc 1.000 0.315 0.400
Time2:Treathrcc 0.315 1.000 0.437
Time3:Treathrcc 0.400 0.437 1.000

The correlation is highest between times 2 and 3.

4.2.6 The design matrix


Before we fit GLMs, we need to define our design matrix based on the experimental design.
We want to test for differential expressions between hrcC challenged and mock-inoculated
samples within batches, i.e. adjusting for differences between batches. In statistical terms,
this is an additive linear model. So the design matrix is created as:

54
> design <- model.matrix(~Time+Treat)
> rownames(design) <- colnames(y)
> design
(Intercept) Time2 Time3 Treathrcc
mock1 1 0 0 0
mock2 1 1 0 0
mock3 1 0 1 0
hrcc1 1 0 0 1
hrcc2 1 1 0 1
hrcc3 1 0 1 1
attr(,"assign")
[1] 0 1 1 2
attr(,"contrasts")
attr(,"contrasts")$Time
[1] "contr.treatment"

attr(,"contrasts")$Treat
[1] "contr.treatment"

4.2.7 Estimating the dispersion


Estimate the genewise dispersion estimates over all genes, allowing for a possible abundance
trend. The estimation is also robustified against potential outlier genes.
> y <- estimateDisp(y, design, robust=TRUE)
> y$common.dispersion
[1] 0.0705
> plotBCV(y)

55
The square root of dispersion is the coefficient of biological variation (BCV). The common
BCV is on the high side, considering that this is a designed experiment using genetically
identical plants. The trended dispersion shows a decreasing trend with expression level. At
low logCPM, the dispersions are very large indeed.
Note that only the trended dispersion is used under the quasi-likelihood (QL) pipeline.
The tagwise and common estimates are shown here but will not be used further.
The QL dispersions can be estimated using the glmQLFit function, and then be visualized
with the plotQLDisp function.

> fit <- glmQLFit(y, design, robust=TRUE)


> plotQLDisp(fit)

4.2.8 Differential expression


Now we test for significant differential expression in each gene using the QL F-test.
First we check whether there was a genuine need to adjust for the experimental times. We
do this by testing for differential expression between the three times. There is considerable
differential expression, justifying our decision to adjust for the batch effect:
> qlf <- glmQLFTest(fit, coef=2:3)
> topTags(qlf)
Coefficient: Time2 Time3
logFC.Time2 logFC.Time3 logCPM F PValue FDR
AT5G66800 5.58 -1.065 5.48 150.1 8.93e-10 1.48e-05
AT5G23000 5.58 -0.292 5.71 127.5 2.48e-09 2.05e-05

56
AT5G31702 5.83 -2.568 5.95 113.9 5.03e-09 2.77e-05
AT2G45830 5.42 -0.589 4.71 108.4 6.84e-09 2.83e-05
AT3G33004 4.81 -1.763 5.63 102.8 9.47e-09 3.13e-05
AT2G11230 3.50 -1.532 5.60 98.7 1.22e-08 3.36e-05
AT2G07782 3.48 -1.616 5.28 93.5 1.70e-08 4.01e-05
AT2G18193 3.05 -2.396 5.08 84.8 3.09e-08 6.04e-05
AT2G23910 3.59 -0.384 5.13 83.9 3.29e-08 6.04e-05
AT5G54830 3.07 -0.367 6.07 79.7 4.51e-08 7.31e-05
> FDR <- p.adjust(qlf$table$PValue, method="BH")
> sum(FDR < 0.05)
[1] 1628

Now conduct QL F-tests for the pathogen effect and show the top genes. By default, the
test is for the last coefficient in the design matrix, which in this case is the treatment effect:

> qlf <- glmQLFTest(fit)


> topTags(qlf)
Coefficient: Treathrcc
logFC logCPM F PValue FDR
AT2G19190 4.50 7.37 304 1.83e-10 2.62e-06
AT2G39530 4.34 6.71 278 3.17e-10 2.62e-06
AT3G46280 4.78 8.10 247 6.70e-10 2.78e-06
AT2G39380 4.94 5.77 247 6.72e-10 2.78e-06
AT1G51800 3.97 7.71 232 9.92e-10 3.28e-06
AT1G51850 5.32 5.42 209 1.89e-09 4.30e-06
AT5G48430 6.32 6.73 203 2.30e-09 4.30e-06
AT2G44370 5.41 5.20 200 2.50e-09 4.30e-06
AT1G51820 4.34 6.37 198 2.64e-09 4.30e-06
AT3G55150 5.78 4.90 196 2.80e-09 4.30e-06

Heres a closer look at the individual counts-per-million for the top genes. The top genes are
very consistent across the three replicates:
> top <- rownames(topTags(qlf))
> cpm(y)[top,]
mock1 mock2 mock3 hrcc1 hrcc2 hrcc3
AT2G19190 16.696 12.0 13.29 341.3 254.7 351.1
AT2G39530 7.001 9.0 13.29 158.1 191.9 243.1
AT3G46280 18.850 17.0 18.40 384.8 374.5 820.9
AT2G39380 2.154 3.0 4.77 91.6 84.4 135.1
AT1G51800 29.083 16.5 30.66 362.4 347.8 464.0
AT1G51850 1.077 1.0 3.75 78.1 56.3 108.9
AT5G48430 4.309 4.5 0.00 189.1 314.6 125.1
AT2G44370 2.154 1.0 1.70 57.0 67.1 86.0
AT1G51820 9.694 7.5 6.13 121.2 156.6 191.3
AT3G55150 0.539 1.0 1.36 43.1 64.9 64.4

57
The total number of genes significantly up-regulated or down-regulated at 5% FDR is
summarized as follows:
> summary(decideTests(qlf))
Treathrcc
-1 837
0 14797
1 892

We can plot all the logFCs against average count size, highlighting the DE genes:

> plotMD(qlf)
> abline(h=c(-1,1), col="blue")

The blue lines indicate 2-fold up or down.

4.2.9 Setup
This analysis was conducted on:
> sessionInfo()
R version 3.3.3 (2017-03-06)
Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 7 x64 (build 7601) Service Pack 1

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252

58
[3] LC_MONETARY=English_Australia.1252 LC_NUMERIC=C
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] parallel stats4 stats graphics grDevices utils datasets methods base

other attached packages:


[1] GO.db_3.4.0 org.Mm.eg.db_3.4.0 tweeDEseqCountData_1.12.0
[4] NBPSeq_0.3.0 org.Hs.eg.db_3.4.0 AnnotationDbi_1.36.2
[7] IRanges_2.8.2 S4Vectors_0.12.2 Biobase_2.34.0
[10] BiocGenerics_0.20.0 edgeR_3.17.9 limma_3.30.13

loaded via a namespace (and not attached):


[1] Rcpp_0.12.10 magrittr_1.5 splines_3.3.3 munsell_0.4.3 statmod_1.4.29
[6] colorspace_1.3-2 lattice_0.20-34 stringr_1.2.0 plyr_1.8.4 tools_3.3.3
[11] grid_3.3.3 gtable_0.2.0 DBI_0.6 assertthat_0.1 lazyeval_0.2.0
[16] digest_0.6.12 tibble_1.2 reshape2_1.4.2 ggplot2_2.2.1 memoise_1.0.0
[21] qvalue_2.6.0 RSQLite_1.1-2 stringi_1.1.2 scales_0.4.1 locfit_1.5-9.1

4.3 Profiles of Yoruba HapMap individuals


4.3.1 Background
RNA-Seq profiles were made of cell lines derived from lymphoblastoid cells from 69 different
Yoruba individuals from Ibadan, Nigeria [22] [23]. The profiles were generated as part of the
International HapMap project [10]. RNA from each individual was sequenced on at least
two lanes of an Illumina Genome Analyser 2, and mapped reads to the human genome using
MAQ v0.6.8.
The study group here is essentially an opportunity sample and the individuals are likely
to be genetically diverse. In this analysis we look at genes that are differentially expressed
between males and female.

4.3.2 Loading the data


Read counts summarized by Ensembl gene identifiers are available in the tweeDEseqCount-
Data package:

> library(tweeDEseqCountData)
> data(pickrell1)
> Counts <- exprs(pickrell1.eset)
> dim(Counts)

[1] 38415 69

59
> Counts[1:5,1:5]

NA18486 NA18498 NA18499 NA18501 NA18502


ENSG00000127720 6 32 14 35 14
ENSG00000242018 20 21 24 22 16
ENSG00000224440 0 0 0 0 0
ENSG00000214453 0 0 0 0 0
ENSG00000237787 0 0 1 0 0

In this analysis we will compare female with male individuals.

> Gender <- pickrell1.eset$gender


> table(Gender)

Gender
female male
40 29

> rm(pickrell1.eset)

Annotation for each Ensemble gene is also available from the tweeDEseqCountData pack-
age:

> data(annotEnsembl63)
> annot <- annotEnsembl63[,c("Symbol","Chr")]
> annot[1:5,]

Symbol Chr
ENSG00000252775 U7 5
ENSG00000207459 U6 5
ENSG00000252899 U7 5
ENSG00000201298 U6 5
ENSG00000222266 U6 5

> rm(annotEnsembl63)

Form a DGEList object combining the counts and associated annotation:

> library(edgeR)
> y <- DGEList(counts=Counts, genes=annot[rownames(Counts),])

60
4.3.3 Filtering and normalization
Keep genes with least 1 count-per-million reads (cpm) in at least 20 samples:

> isexpr <- rowSums(cpm(y)>1) >= 20

Keep only genes with defined annotation, and recompute library sizes:

> hasannot <- rowSums(is.na(y$genes))==0


> y <- y[isexpr & hasannot, , keep.lib.sizes=FALSE]
> dim(y)

[1] 17310 69

The library sizes vary from about 5 million to over 15 million:

> barplot(y$samples$lib.size*1e-6, names=1:69, ylab="Library size (millions)")

Apply TMM normalization to account for the composition biases:

> y <- calcNormFactors(y)


> head(y$samples)

group lib.size norm.factors


NA18486 1 7749527 0.939
NA18498 1 13612983 1.110
NA18499 1 8569631 0.963
NA18501 1 8595024 1.201
NA18502 1 13375275 0.938
NA18504 1 9881732 0.979

61
4.3.4 Estimating the dispersion
We are interested in the differences between male and female. Hence, we create a design
matrix using the gender factor. We estimate the NB dispersion using estimateDisp. The
estimation is robustified against potential outlier genes.

> design <- model.matrix(~Gender)


> y <- estimateDisp(y, design, robust=TRUE)
> plotBCV(y)

We then estimate the QL dispersions around the dispersion trend using glmQLFit. The
large number of cases and the high variability means that the QL dispersions are not squeezed
very heavily from the raw values:

> fit <- glmQLFit(y, design, robust=TRUE)


> plotQLDisp(fit)

62
4.3.5 Differential expression
Now find genes differentially expressed between male and females. Positive log-fold-changes
mean higher expression in males. The highly ranked genes are mostly on the X or Y chro-
mosomes. Top ranked is the famous XIST gene, which is known to be expressed only in
females.

> qlf <- glmQLFTest(fit)


> topTags(qlf,n=15)

Coefficient: Gendermale
Symbol Chr logFC logCPM F PValue FDR
ENSG00000229807 XIST X -9.49 7.249 1213 1.03e-46 1.78e-42
ENSG00000099749 CYorf15A Y 4.28 1.757 857 1.19e-41 1.03e-37
ENSG00000131002 CYorf15B Y 5.63 2.055 587 2.66e-36 1.31e-32
ENSG00000157828 RPS4Y2 Y 3.18 4.207 585 3.02e-36 1.31e-32
ENSG00000233864 TTTY15 Y 4.84 1.254 538 4.42e-35 1.53e-31
ENSG00000198692 EIF1AY Y 2.36 3.247 376 3.04e-30 8.78e-27
ENSG00000165246 NLGN4Y Y 5.09 1.676 303 1.70e-27 4.21e-24
ENSG00000183878 UTY Y 1.86 3.137 253 3.24e-25 7.01e-22
ENSG00000243209 AC010889.1 Y 2.66 0.797 232 3.63e-24 6.29e-21
ENSG00000129824 RPS4Y1 Y 2.53 5.401 232 3.63e-24 6.29e-21
ENSG00000012817 KDM5D Y 1.47 4.950 222 1.16e-23 1.82e-20
ENSG00000213318 RP11-331F4.1 16 3.67 3.688 217 2.87e-23 4.13e-20
ENSG00000067048 DDX3Y Y 1.62 5.621 181 2.48e-21 3.30e-18
ENSG00000146938 NLGN4X X 3.94 1.048 139 1.81e-18 2.24e-15
ENSG00000232928 RP13-204A15.4 X 1.44 3.558 111 3.19e-16 3.68e-13

63
> summary(decideTests(qlf))

Gendermale
-1 46
0 17243
1 21

4.3.6 Gene set testing


The tweeDEseqCountData package includes a list of genes belonging to the male-specific
region of chromosome Y, and a list of genes located in the X chromosome that have been
reported to escape X-inactivation. We expect genes in the first list to be up-regulated in
males, whereas genes in the second list should be up-regulated in females.

> data(genderGenes)
> Ymale <- rownames(y) %in% msYgenes
> Xescape <- rownames(y) %in% XiEgenes

Roast gene set tests by fry() confirm that the male-specific genes are significantly up
as a group in our comparison of males with females, whereas the X genes are significantly
down as a group [33].

> index <- list(Y=Ymale, X=Xescape)


> fry(y, index=index, design=design)

NGenes Direction PValue FDR PValue.Mixed FDR.Mixed


Y 12 Up 7.04e-46 1.41e-45 5.86e-11 5.86e-11
X 46 Down 7.25e-17 7.25e-17 2.28e-66 4.55e-66

A barcode plot can be produced to visualize the results. Genes are ranked from left to
right by decreasing log-fold-change in the background of the barcode plot. Genes in the set
of msYgenes are represented by red bars whereas genes in the set of XiEgenes are represented
by blue bars. The line above the barcode shows the relative local enrichment of the vertical
bars in each part of the plot. This particular plot suggests that the male-specific genes tend
to have large positive log-fold-changes, whereas the X genes tend to have large negative
log-fold-changes.

> barcodeplot(qlf$table$logFC, index[[1]], index[[2]])

64
The results from competitive camera gene sets tests are even more convincing [34]. The
positive intergene correlations here show that the genes in each set tend to be biologically
correlated:

> camera(y, index, design)

NGenes Direction PValue FDR


Y 12 Up 1.27e-295 2.55e-295
X 46 Down 3.02e-25 3.02e-25

See where the X and Y genes fall on the MA plot:

> with(qlf$table, plot(logCPM,logFC,pch=16,cex=0.2))


> with(qlf$table, points(logCPM[Xescape],logFC[Xescape],pch=16,col="blue"))
> with(qlf$table, points(logCPM[Ymale],logFC[Ymale],pch=16,col="red"))
> legend("bottomleft",legend=c("Ymale genes","Xescape genes"),pch=16,,col=c("red","blue"))

65
4.3.7 Setup
This analysis was conducted on:

> sessionInfo()

R version 3.3.3 (2017-03-06)


Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 7 x64 (build 7601) Service Pack 1

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC_MONETARY=English_Australia.1252 LC_NUMERIC=C
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] parallel stats4 stats graphics grDevices utils datasets methods base

other attached packages:


[1] GO.db_3.4.0 org.Mm.eg.db_3.4.0 tweeDEseqCountData_1.12.0
[4] NBPSeq_0.3.0 org.Hs.eg.db_3.4.0 AnnotationDbi_1.36.2
[7] IRanges_2.8.2 S4Vectors_0.12.2 Biobase_2.34.0
[10] BiocGenerics_0.20.0 edgeR_3.17.9 limma_3.30.13

loaded via a namespace (and not attached):


[1] Rcpp_0.12.10 magrittr_1.5 splines_3.3.3 munsell_0.4.3 statmod_1.4.29
[6] colorspace_1.3-2 lattice_0.20-34 stringr_1.2.0 plyr_1.8.4 tools_3.3.3
[11] grid_3.3.3 gtable_0.2.0 DBI_0.6 assertthat_0.1 lazyeval_0.2.0

66
[16] digest_0.6.12 tibble_1.2 reshape2_1.4.2 ggplot2_2.2.1 memoise_1.0.0
[21] qvalue_2.6.0 RSQLite_1.1-2 stringi_1.1.2 scales_0.4.1 locfit_1.5-9.1

4.4 RNA-Seq profiles of mouse mammary gland


4.4.1 Introduction
The RNA-Seq data of this case study is described in Fu et al. [8]. The sequence and count
data are publicly available from the Gene Expression Omnibus (GEO) at the series accession
number GSE60450. This study examines the expression profiles of basal stem-cell enriched
cells (B) and committed luminal cells (L) in the mammary gland of virgin, pregnant and
lactating mice. Six groups are present, with one for each combination of cell type and mouse
status. Each group contains two biological replicates. This is summarized in the table below,
where the basal and luminal cell types are abbreviated with B and L respectively.

> targets <- read.delim("targets.txt", header=TRUE)


> targets

FileName GEOAccession CellType Status


1 SRR1552450.fastq GSM1480297 B virgin
2 SRR1552451.fastq GSM1480298 B virgin
3 SRR1552452.fastq GSM1480299 B pregnant
4 SRR1552453.fastq GSM1480300 B pregnant
5 SRR1552454.fastq GSM1480301 B lactate
6 SRR1552455.fastq GSM1480302 B lactate
7 SRR1552444.fastq GSM1480291 L virgin
8 SRR1552445.fastq GSM1480292 L virgin
9 SRR1552446.fastq GSM1480293 L pregnant
10 SRR1552447.fastq GSM1480294 L pregnant
11 SRR1552448.fastq GSM1480295 L lactate
12 SRR1552449.fastq GSM1480296 L lactate

The name of the file containing the read sequences for each library is also shown. Each
file is downloaded from the Sequence Read Archive and has an accession number starting
with SRR, e.g., SRR1552450 for the first library in targets.

4.4.2 Read alignment and processing


Prior to read alignment, these files are converted into the FASTQ format using the fastq-dump
utility from the SRA Toolkit. See http://www.ncbi.nlm.nih.gov/books/NBK158900 for how
to download and use the SRA Toolkit.

67
Before the differential expression analysis can proceed, these reads must be aligned to
the mouse genome and counted into annotated genes. This can be achieved with functions
in the Rsubread package [11]. We assume that an index of the mouse genome is already
available - if not, this can be constructed from a FASTA file of the genome sequence with
the buildindex command. In this example, we assume that the prefix for the index files is
mm10. The reads in each FASTQ file are then aligned to the mouse genome, as shown below.

> library(Rsubread)
> output.files <- sub(".fastq", ".bam", targets$FileName)
> align("mm10", readfile1=targets$FileName, phredOffset=33,
+ input_format="FASTQ", output_file=output.files)

This produces a set of BAM files, where each file contains the read alignments for each
library. The mapped reads can be counted into mouse genes by using the featureCounts
function. It uses the exon intervals defined in the NCBI annotation of the mm10 genome.

> fc <- featureCounts(output.files, annot.inbuilt="mm10")


> colnames(fc$counts) <- 1:12
> head(fc$counts)

1 2 3 4 5 6 7 8 9 10 11 12
497097 438 300 65 237 354 287 0 0 0 0 0 0
100503874 1 0 1 1 0 4 0 0 0 0 0 0
100038431 0 0 0 0 0 0 0 0 0 0 0 0
19888 1 1 0 0 0 0 10 3 10 2 0 0
20671 106 182 82 105 43 82 16 25 18 8 3 10
27395 309 234 337 300 290 270 560 464 489 328 307 342

The row names of the matrix represent the Entrez gene identifiers for each gene. In the
output from featureCounts, the column names of fc$counts are the output file names from
align. Here, we simplify them for brevity.

4.4.3 Count loading and annotation


We create a DGEList object as follows

> group <- factor(paste0(targets$CellType, ".", targets$Status))


> y <- DGEList(fc$counts, group=group)
> colnames(y) <- targets$GEO

Human-readable gene symbols can also be added to complement the Entrez identifiers
for each gene, using the annotation in the org.Mm.eg.db package.

68
> require(org.Mm.eg.db)
> y$genes <- select(org.Mm.eg.db,keys=rownames(y),columns="SYMBOL")
> head(y$genes)

ENTREZID SYMBOL
1 497097 Xkr4
2 100503874 Gm19938
3 100038431 Gm10568
4 19888 Rp1
5 20671 Sox17
6 27395 Mrpl15

4.4.4 Filtering and normalization


Here, a gene is only retained if it is expressed at a count-per-million (CPM) above 0.5 in at
least two samples.

> keep <- rowSums(cpm(y) > 0.5) >= 2


> summary(keep)

Mode FALSE TRUE NAs


logical 11375 15804 0

> y <- y[keep, , keep.lib.sizes=FALSE]

TMM normalization is performed to eliminate composition biases between libraries.

> y <- calcNormFactors(y)


> y$samples

group lib.size norm.factors


GSM1480297 B.virgin 23218026 1.237
GSM1480298 B.virgin 21768136 1.214
GSM1480299 B.pregnant 24091588 1.126
GSM1480300 B.pregnant 22656713 1.070
GSM1480301 B.lactate 21522033 1.036
GSM1480302 B.lactate 20008326 1.087
GSM1480291 L.virgin 20384562 1.368
GSM1480292 L.virgin 21698793 1.365
GSM1480293 L.pregnant 22235847 1.005
GSM1480294 L.pregnant 21982745 0.923
GSM1480295 L.lactate 24719697 0.529
GSM1480296 L.lactate 24652963 0.535

69
The performance of the TMM normalization procedure can be examined using mean-
difference (MD) plots. This visualizes the library size-adjusted log-fold change between two
libraries (the difference) against the average log-expression across those libraries (the mean).
The following MD plot is generated by comparing sample 1 against an artificial library
constructed from the average of all other samples.

> plotMD(cpm(y, log=TRUE), column=1)


> abline(h=0, col="red", lty=2, lwd=2)

Ideally, the bulk of genes should be centred at a log-fold change of zero. This indicates
that any composition bias between libraries has been successfully removed. This quality
check should be repeated by constructing a MD plot for each sample.

4.4.5 Data exploration


The data can be explored by generating multi-dimensional scaling (MDS) plots. This visu-
alizes the differences between the expression profiles of different samples in two dimensions.

> points <- c(0,1,2,15,16,17)


> colors <- rep(c("blue", "darkgreen", "red"), 2)
> plotMDS(y, col=colors[group], pch=points[group])
> legend("topleft", legend=levels(group), pch=points, col=colors, ncol=2)

70
Replicate samples from the same group cluster together in the plot, while samples from
different groups form separate clusters. This indicates that the differences between groups
are larger than those within groups, i.e., differential expression is greater than the variance
and can be detected. The distance between basal samples on the left and luminal cells on
the right is about 6 units, corresponding to a leading fold change of about 64-fold (26 = 64)
between basal and luminal. The expression differences between virgin, pregnant and lactating
are greater for luminal cells than for basal.

4.4.6 The design matrix


The experimental design for this study can be parametrized with a one-way layout, whereby
one coefficient is assigned to each group. The design matrix contains the predictors for each
sample and and is constructed using the code below.

> design <- model.matrix(~ 0 + group)


> colnames(design) <- levels(group)
> design

B.lactate B.pregnant B.virgin L.lactate L.pregnant L.virgin


1 0 0 1 0 0 0
2 0 0 1 0 0 0
3 0 1 0 0 0 0
4 0 1 0 0 0 0
5 1 0 0 0 0 0
6 1 0 0 0 0 0
7 0 0 0 0 0 1

71
8 0 0 0 0 0 1
9 0 0 0 0 1 0
10 0 0 0 0 1 0
11 0 0 0 1 0 0
12 0 0 0 1 0 0
attr(,"assign")
[1] 1 1 1 1 1 1
attr(,"contrasts")
attr(,"contrasts")$group
[1] "contr.treatment"

4.4.7 Estimating the dispersion


The NB dispersion is estimated using the estimateDisp function. This returns the DGEList
object with additional entries for the estimated NB dispersions for all gene. These estimates
can be visualized with plotBCV, which shows the root-estimate, i.e., the biological coefficient
of variation for each gene.

> y <- estimateDisp(y, design, robust=TRUE)


> y$common.dispersion

[1] 0.0134

> plotBCV(y)

72
Note that only the trended dispersion is used under the quasi-likelihood (QL) pipeline. The
tagwise and common estimates are shown here but will not be used further.
For the QL dispersions, estimation can be performed using the glmQLFit function. This
returns a DGEGLM object containing the estimated values of the GLM coefficients for each
gene, as well as the fitted mean-QL dispersion trend, the squeezed QL estimates and the
prior degrees of freedom (df). These can be visualized with the plotQLDisp function.

> fit <- glmQLFit(y, design, robust=TRUE)


> head(fit$coefficients)

B.lactate B.pregnant B.virgin L.lactate L.pregnant L.virgin


497097 -11.14 -12.02 -11.23 -19.0 -19.03 -19.0
20671 -12.77 -12.51 -12.15 -14.5 -14.31 -14.1
27395 -11.27 -11.30 -11.53 -10.6 -10.87 -10.9
18777 -10.15 -10.21 -10.77 -10.1 -10.39 -10.4
21399 -9.89 -9.74 -9.79 -10.2 -9.97 -10.0
58175 -16.16 -14.85 -15.99 -13.3 -12.29 -12.1

> plotQLDisp(fit)

Setting robust=TRUE in glmQLFit is strongly recommended [21]. Setting robust=TRUE in


estimateDisp has no effect on the downstream analysis, but is nevertheless very useful as it
identifies genes that are outliers from the mean-NB dispersion trend.

73
4.4.8 Differential expression
We test for significant differential expression in each gene, using the QL F-test. The contrast
of interest can be specified using the makeContrasts function. Here, genes are tested for DE
between the basal pregnant and lactating groups. This is done by defining the null hypothesis
as B.pregnant - B.lactate = 0.

> con <- makeContrasts(B.pregnant - B.lactate, levels=design)


> qlf <- glmQLFTest(fit, contrast=con)

The top set of most significant genes can be examined with topTags. Here, a positive
log-fold change represents genes that are up in B.pregnant over B.lactate. Multiplicity
correction is performed by applying the Benjamini-Hochberg method on the p-values, to
control the false discovery rate (FDR).

> topTags(qlf)

Coefficient: -1*B.lactate 1*B.pregnant


ENTREZID SYMBOL logFC logCPM F PValue FDR
18071 12992 Csn1s2b -6.09 10.18 421 4.86e-11 7.68e-07
22881 211577 Mrgprf -5.15 2.74 345 1.30e-10 8.05e-07
12177 226101 Myof -2.32 6.44 322 1.97e-10 8.05e-07
851 381290 Atp2b4 -2.14 6.14 320 2.04e-10 8.05e-07
9279 140474 Muc4 7.17 6.05 308 2.64e-10 8.34e-07
18829 231830 Micall2 2.25 5.18 282 4.47e-10 1.18e-06
2491 24117 Wif1 1.82 6.76 260 7.30e-10 1.65e-06
18684 12740 Cldn4 5.32 9.87 298 8.88e-10 1.71e-06
22829 21953 Tnni2 -5.75 3.86 313 9.76e-10 1.71e-06
19483 231991 Creb5 -2.57 4.87 241 1.16e-09 1.83e-06

The top gene Csn1s2b has a large negative log2-fold-change, showing that it is far more
highly expressed in lactating than pregnant mice. This gene is known to be a major source
of protein in milk.
The total number of DE genes in each direction at a FDR of 5% can be examined
with decideTests. There are in fact nearly 4500 DE genes an FDR cut-off of 5% in this
comparison:

> summary(decideTests(qlf))

-1*B.lactate 1*B.pregnant
-1 2505
0 10529
1 2770

74
The differential expression test results can be visualized using a smear plot. The log-fold
change for each gene is plotted against the average abundance, i.e., logCPM in the result table
above. Significantly DE genes at a FDR of 5% are highlighted in red.

> plotMD(qlf)

We use glmTreat to narrow down the list of DE genes and focus on genes that are more
biologically meaningful. We test whether the differential expression is significantly above a
log2-fold-change of log2 1.2, i.e., a fold-change of 1.2.

> tr <- glmTreat(fit, contrast=con, lfc=log2(1.2))


> topTags(tr)

Coefficient: -1*B.lactate 1*B.pregnant


ENTREZID SYMBOL logFC unshrunk.logFC logCPM PValue FDR
18071 12992 Csn1s2b -6.09 -6.09 10.18 5.13e-11 8.11e-07
22881 211577 Mrgprf -5.15 -5.15 2.74 1.40e-10 9.78e-07
12177 226101 Myof -2.32 -2.32 6.44 2.82e-10 9.78e-07
9279 140474 Muc4 7.17 7.34 6.05 2.92e-10 9.78e-07
851 381290 Atp2b4 -2.14 -2.14 6.14 3.09e-10 9.78e-07
18829 231830 Micall2 2.25 2.25 5.18 6.55e-10 1.72e-06
18684 12740 Cldn4 5.32 5.32 9.87 9.41e-10 2.02e-06
22829 21953 Tnni2 -5.75 -5.76 3.86 1.02e-09 2.02e-06
2491 24117 Wif1 1.82 1.82 6.76 1.30e-09 2.28e-06
19483 231991 Creb5 -2.57 -2.57 4.87 1.54e-09 2.44e-06

75
Around 3000 genes are detected as DE with fold-change significantly above 1.2 at an
FDR cut-off of 5%.

> summary(decideTests(tr))

-1*B.lactate 1*B.pregnant
-1 1428
0 12566
1 1810

The test results are visualized in the following smear plot. Genes that are significantly
DE above a fold-change of 1.2 at an FDR of 5% are highlighted in red.

> plotMD(tr)

4.4.9 ANOVA-like testing


The differential expression analysis of two-group comparison can be easily extended to com-
parisons between three or more groups. This is done by creating a matrix of contrasts, where
which each column represents a contrast between two groups of interest. In this manner,
users can perform a one-way analysis of variance (ANOVA) for each gene.
As an example, suppose we want to compare the three groups in the luminal population,
i.e., virgin, pregnant and lactating. An appropriate contrast matrix can be created as shown
below, to make pairwise comparisons between all three groups.

76
> con <- makeContrasts(
+ L.PvsL = L.pregnant - L.lactate,
+ L.VvsL = L.virgin - L.lactate,
+ L.VvsP = L.virgin - L.pregnant, levels=design)

The QL F-test is then applied to identify genes that are DE among the three groups.
This combines the three pairwise comparisons into a single F-statistic and p-value. The top
set of significant genes can be displayed with topTags.

> anov <- glmQLFTest(fit, contrast=con)


> topTags(anov)

Coefficient: LR test on 2 degrees of freedom


ENTREZID SYMBOL logFC.L.PvsL logFC.L.VvsL logFC.L.VvsP logCPM F PValue FDR
19230 19242 Ptn -1.54 7.26 8.801 7.97 2387 3.77e-17 5.96e-13
15679 13645 Egf -5.36 -7.22 -1.864 3.67 1126 4.46e-15 3.22e-11
21207 52150 Kcnk6 -2.42 -7.00 -4.578 5.91 1020 8.40e-15 3.22e-11
23907 15439 Hp 1.08 5.42 4.336 4.93 992 1.00e-14 3.22e-11
18071 12992 Csn1s2b -8.55 -11.36 -2.810 10.18 1050 1.03e-14 3.22e-11
22626 14183 Fgfr2 -1.15 3.95 5.096 7.38 953 1.29e-14 3.22e-11
2901 20856 Stc2 -1.81 3.19 5.006 6.10 917 1.64e-14 3.22e-11
20062 11941 Atp2b2 -7.37 -10.56 -3.190 6.60 1133 1.79e-14 3.22e-11
9083 13358 Slc25a1 -4.13 -4.91 -0.784 7.49 888 2.01e-14 3.22e-11
8278 17068 Ly6d 3.42 9.24 5.820 4.68 886 2.04e-14 3.22e-11

Note that the three contrasts of pairwise comparisons are linearly dependent. Construct-
ing the contrast matrix with any two of the contrasts would be sufficient to specify an
ANOVA test. For instance, the contrast matrix shown below produces the same test results
but with a different column of log-fold changes.

> con <- makeContrasts(


+ L.PvsL = L.pregnant - L.lactate,
+ L.VvsP = L.virgin - L.pregnant, levels=design)

4.4.10 Gene ontology analysis


Further analyses are required to interpret the differential expression results in a biological
context. One common downstream procedure is a gene ontology (GO) enrichment analysis.
Suppose we want to identify GO terms that are over-represented in the basal lactating
group compared to the basal pregnancy group. This can be achieved by applying the goana
function to the differential expression results of that comparison. The top set of most enriched
GO terms can be viewed with the topGO function.

77
> con <- makeContrasts(B.lactate - B.pregnant, levels=design)
> qlf <- glmQLFTest(fit, contrast=con)
> go <- goana(qlf, species = "Mm")
> topGO(go, n=30)

Term Ont N Up Down P.Up P.Down


GO:0044822 poly(A) RNA binding MF 1098 108 396 1.000 1.60e-53
GO:0003723 RNA binding MF 1461 159 474 1.000 3.65e-49
GO:0042254 ribosome biogenesis BP 247 8 141 1.000 2.80e-45
GO:0022613 ribonucleoprotein complex biogenesis BP 361 24 177 1.000 4.16e-44
GO:0030529 intracellular ribonucleoprotein complex CC 686 48 268 1.000 6.07e-43
GO:1990904 ribonucleoprotein complex CC 686 48 268 1.000 6.07e-43
GO:0022626 cytosolic ribosome CC 102 1 78 1.000 5.39e-39
GO:0006364 rRNA processing BP 168 4 98 1.000 7.70e-33
GO:0016072 rRNA metabolic process BP 171 6 98 1.000 5.83e-32
GO:0005730 nucleolus CC 667 80 240 1.000 8.59e-32
GO:0003676 nucleic acid binding MF 2878 429 720 0.999 1.74e-30
GO:0005840 ribosome CC 205 4 103 1.000 3.84e-27
GO:0044391 ribosomal subunit CC 158 1 87 1.000 8.53e-27
GO:0022625 cytosolic large ribosomal subunit CC 57 0 47 1.000 1.24e-26
GO:0032991 macromolecular complex CC 4083 606 938 1.000 1.47e-26
GO:0070013 intracellular organelle lumen CC 2889 416 705 1.000 3.04e-26
GO:0031974 membrane-enclosed lumen CC 2892 416 705 1.000 4.21e-26
GO:0043233 organelle lumen CC 2892 416 705 1.000 4.21e-26
GO:0044445 cytosolic part CC 197 18 98 0.999 1.87e-25
GO:0031981 nuclear lumen CC 2596 390 638 0.996 3.19e-24
GO:1901363 heterocyclic compound binding MF 4361 673 979 0.998 3.69e-24
GO:0003735 structural constituent of ribosome MF 173 4 88 1.000 7.50e-24
GO:0034470 ncRNA processing BP 298 15 125 1.000 1.56e-23
GO:0097159 organic cyclic compound binding MF 4407 681 984 0.998 1.97e-23
GO:0006396 RNA processing BP 717 61 232 1.000 2.43e-23
GO:0030684 preribosome CC 70 0 50 1.000 3.75e-23
GO:0034660 ncRNA metabolic process BP 386 26 148 1.000 6.02e-23
GO:0044428 nuclear part CC 3016 458 714 0.996 1.34e-22
GO:0042273 ribosomal large subunit biogenesis BP 65 1 47 1.000 3.28e-22
GO:0005634 nucleus CC 5464 906 1166 0.683 4.88e-21

The row names of the output are the universal identifiers of the GO terms, with one term
per row. The Term column gives the names of the GO terms. These terms cover three domains
- biological process (BP), cellular component (CC) and molecular function (MF), as shown
in the Ont column. The N column represents the total number of genes that are annotated
with each GO term. The Up and Down columns represent the number of genes with the GO
term that are significantly up- and down-regulated in this differential expression comparison,
respectively. The P.Up and P.Down columns contain the p-values for over-representation of
the GO term across the set of up- and down-regulated genes, respectively. The output table
is sorted by the minimum of P.Up and P.Down by default.
The goana function uses the NCBI RefSeq annotation. Therefore, the Entrez Gene iden-

78
tifier (ID) should be supplied for each gene as the row names of qlf.

4.4.11 Gene set testing


Another downstream step uses the rotation gene set test (ROAST) [33]. Given a set of
genes, we can test whether the majority of the genes in the set are DE across the contrast
of interest. It is useful when the specified set contains all genes involved in some pathway or
process.
In our case study, suppose we are interested in three GO terms related to cytokinesis.
Each term will be used to define a set containing all genes that are annotated with that
term. The names of these terms can be viewed as shown below.

> library(GO.db)
> cyt.go <- c("GO:0032465", "GO:0000281", "GO:0000920")
> term <- select(GO.db, keys=cyt.go, columns="TERM")
> term

GOID TERM
1 GO:0032465 regulation of cytokinesis
2 GO:0000281 mitotic cytokinesis
3 GO:0000920 cell separation after cytokinesis

We construct a list of three components, each of which is a vector of Entrez Gene IDs
for all genes annotated with one of the GO terms. We then convert the Gene IDs into row
indices of the fit object using the function ids2indices.

> Rkeys(org.Mm.egGO2ALLEGS) <- cyt.go


> ind <- ids2indices(as.list(org.Mm.egGO2ALLEGS), fit$genes$ENTREZID)

We proceed to run ROAST on the defined gene sets for the contrast of interest. Suppose
the comparison of interest is between the virgin and lactating groups in the basal population.
We use fry to test for multiple gene sets.

> con <- makeContrasts(B.virgin-B.lactate, levels=design)


> fr <- fry(y, index=ind, design=design, contrast=con)
> fr

NGenes Direction PValue FDR PValue.Mixed FDR.Mixed


GO:0032465 48 Up 0.000471 0.00141 3.72e-06 6.96e-06
GO:0000920 16 Down 0.001839 0.00276 4.64e-06 6.96e-06
GO:0000281 33 Up 0.005928 0.00593 2.12e-05 2.12e-05

Each row corresponds to a single gene set, i.e., GO term. The NGenes column gives the
number of genes in each set. The net direction of change is determined from the significance

79
of changes in each direction, and is shown in the Direction column. The PValue provides
evidence for whether the majority of genes in the set are DE in the specified direction, whereas
the PValue.Mixed tests for differential expression in any direction. FDRs are computed from
the corresponding p-values across all sets.
A barcode plot can be produced with the barcodeplot function to visualize the results
for any particular set. In this case, visualization is performed for the gene set defined
by GO:0032465. Here, genes are represented by bars and are ranked from left to right
by decreasing log-fold change. This forms the barcode-like pattern. The line above the
barcode shows the relative local enrichment of the vertical bars in each part of the plot.
This particular plot suggests that most genes in this set are up-regulated in the virgin group
compared to the lactating group.

> res <- glmQLFTest(fit, contrast=con)


> barcodeplot(res$table$logFC, ind[[1]], main=names(ind)[1])

4.4.12 Setup
This analysis was conducted on:

> sessionInfo()

R version 3.3.3 (2017-03-06)


Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 7 x64 (build 7601) Service Pack 1

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC_MONETARY=English_Australia.1252 LC_NUMERIC=C

80
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] parallel stats4 stats graphics grDevices utils datasets methods base

other attached packages:


[1] GO.db_3.4.0 org.Mm.eg.db_3.4.0 tweeDEseqCountData_1.12.0
[4] NBPSeq_0.3.0 org.Hs.eg.db_3.4.0 AnnotationDbi_1.36.2
[7] IRanges_2.8.2 S4Vectors_0.12.2 Biobase_2.34.0
[10] BiocGenerics_0.20.0 edgeR_3.17.9 limma_3.30.13

loaded via a namespace (and not attached):


[1] Rcpp_0.12.10 magrittr_1.5 splines_3.3.3 munsell_0.4.3 statmod_1.4.29
[6] colorspace_1.3-2 lattice_0.20-34 stringr_1.2.0 plyr_1.8.4 tools_3.3.3
[11] grid_3.3.3 gtable_0.2.0 DBI_0.6 assertthat_0.1 lazyeval_0.2.0
[16] digest_0.6.12 tibble_1.2 reshape2_1.4.2 ggplot2_2.2.1 memoise_1.0.0
[21] qvalue_2.6.0 RSQLite_1.1-2 stringi_1.1.2 scales_0.4.1 locfit_1.5-9.1

4.5 Differential splicing after Pasilla knockdown


4.5.1 Introduction
The RNA-Seq data of this case study was produced by Brooks et al [3]. Drosophila melanogaster
was used as a model system to study the proteins NOVA1 and NOVA2 which are known to
regulate splicing in mammals. In particular, an RNA interference system (RNAi) was used
to knock down the expression of the D. melanogaster ortholog of NOVA1 and NOVA2, which
is Pasilla.
The experiment compared treated and untreated cells from the S2-DRSC cell line. In
this case study we are interested in exons and genes that are differentially expressed after
Pasilla knockdown, as well as genes that are differentially spliced in the knockdown samples
as compared to wildtype.

4.5.2 RNA-Seq samples


The RNA-Seq data of the six samples were deposited on GEO http://www.ncbi.nlm.nih.
gov/geo. The GEO accession numbers and titles were prepared in a csv file:

> library(edgeR)
> GEO <- readTargets("GEO-samples.csv", sep=",")
> GEO

GEO Title Pasilla


1 GSM461176 S2_DRSC_Untreated-1 Normal

81
2 GSM461177 S2_DRSC_Untreated-3 Normal
3 GSM461178 S2_DRSC_Untreated-4 Normal
4 GSM461179 S2_DRSC_CG8144_RNAi-1 Down
5 GSM461180 S2_DRSC_CG8144_RNAi-3 Down
6 GSM461181 S2_DRSC_CG8144_RNAi-4 Down

There are three untreated biological samples, in which Pasilla should be expressed at normal
levels, and three treated biological samples, in which Pasilla should be expressed at reduced
levels.
While GEO records the sample information, the sequencing data file are actually held
on the NCBI Short Read Archive (SRA). The RNA samples were sequenced on an Illumina
Genome Analyzer II. Multiple sequencing runs were used for several of the samples, resulting
in a total of 20 SRA files:

> SRA <- readTargets("SRA-Files.csv", sep=",")


> SRA

SRA GEO Title RunDate FlowCellID Type ReadLength


1 SRR031708 GSM461176 S2_DRSC_Untreated-1 7/15/08 308T2AAXX SE 45
2 SRR031709 GSM461176 S2_DRSC_Untreated-1 7/15/08 308T2AAXX SE 45
3 SRR031710 GSM461176 S2_DRSC_Untreated-1 8/15/08 30AYWAAXX SE 45
4 SRR031711 GSM461176 S2_DRSC_Untreated-1 8/15/08 30AYWAAXX SE 45
5 SRR031712 GSM461176 S2_DRSC_Untreated-1 8/15/08 30AYWAAXX SE 45
6 SRR031713 GSM461176 S2_DRSC_Untreated-1 8/15/08 30AYWAAXX SE 45
7 SRR031714 GSM461177 S2_DRSC_Untreated-3 11/14/08 30MNEAAXX PE 37
8 SRR031715 GSM461177 S2_DRSC_Untreated-3 12/23/08 30M2BAAXX PE 37
9 SRR031716 GSM461178 S2_DRSC_Untreated-4 12/23/08 30M2BAAXX PE 37
10 SRR031717 GSM461178 S2_DRSC_Untreated-4 12/23/08 30M2BAAXX PE 37
11 SRR031718 GSM461179 S2_DRSC_CG8144_RNAi-1 7/15/08 308T2AAXX SE 45
12 SRR031719 GSM461179 S2_DRSC_CG8144_RNAi-1 7/18/08 308UEAAXX SE 45
13 SRR031720 GSM461179 S2_DRSC_CG8144_RNAi-1 8/15/08 30AYWAAXX SE 45
14 SRR031721 GSM461179 S2_DRSC_CG8144_RNAi-1 8/15/08 30AYWAAXX SE 45
15 SRR031722 GSM461179 S2_DRSC_CG8144_RNAi-1 8/15/08 30AYWAAXX SE 45
16 SRR031723 GSM461179 S2_DRSC_CG8144_RNAi-1 8/21/08 308A0AAXX SE 45
17 SRR031724 GSM461180 S2_DRSC_CG8144_RNAi-3 12/23/08 30M2BAAXX PE 37
18 SRR031725 GSM461180 S2_DRSC_CG8144_RNAi-3 12/23/08 30M2BAAXX PE 37
19 SRR031726 GSM461181 S2_DRSC_CG8144_RNAi-4 12/23/08 30M2BAAXX PE 37
20 SRR031727 GSM461181 S2_DRSC_CG8144_RNAi-4 12/23/08 30M2BAAXX PE 37

The last two columns of the above target file indicate whether the samples are single end
(SE) sequencing with 45 base-pair reads or paired end (PE) sequencing with 37 bp reads.

4.5.3 Read alignment and processing


The SRA format files were first converted to FASTQ format using the SRA Toolkit. Then an
index file of the D. melanogaster reference genome was built in Rsubread[11] using the FASTA

82
files downloaded from ftp://ftp.ncbi.nlm.nih.gov/genomes/Drosophila_melanogaster/RELEASE_
5_48. Finally, reads were aligned to the reference D. melanogaster genome using Rsubread.
Next we counted the number of reads or fragments overlapping each annotated exon
of each gene. GFF files containing gene and exon annotation were downloaded from ftp:
//ftp.ncbi.nlm.nih.gov/genomes/Drosophila_melanogaster/RELEASE_5_48. The five *.gff
files, one for each chromosome, were concatenated into one file, and repeated exons instances
of the same exon (same start and stop position) were removed to create a data frame of
start/stop positions called unique.gff. The single end (SE) reads were counted by:

> fc_SE <- featureCounts(SE_bam_files, annot.ext="unique.gff",


+ isGTFAnnotationFile=TRUE, GTF.featureType="exon", GTF.attrType="ID",
+ useMetaFeatures=FALSE, allowMultiOverlap=TRUE)

where SE bam files is a vector of BAM file names for the SE reads. The paired end (PE)
reads were counted by:

> fc_PE <- featureCounts(PE_bam_files, annot.ext="unique.gff",


+ isGTFAnnotationFile=TRUE, GTF.featureType="exon", GTF.attrType="ID",
+ useMetaFeatures=FALSE, allowMultiOverlap=TRUE, isPairedEnd=TRUE)

where PE bam files is a vector of BAM file names for the PE reads.

4.5.4 Count loading and annotation


We create a DGEList object as follows

> y.all <- DGEList(counts=cbind(fc_SE$counts, fc_PE$counts), genes=fc_SE$annotation)


> dim(y.all)

[1] 74184 20

> head(y.all$genes)

GeneID Chr Start End Strand Length


138088 30970 NC_004354.3 138094 139379 - 1286
138087 30970 NC_004354.3 139445 139611 - 167
138089 30970 NC_004354.3 139445 139889 - 445
138086 30970 NC_004354.3 139713 139889 - 177
138091 30971 NC_004354.3 140011 141629 + 1619
138092 30971 NC_004354.3 142415 144271 + 1857

The annotation includes Entrez ID and the length, chromosome and start and stop position
of each exon. We resort the samples back to original SRA order and collapse the data so
that there is a single column for each GEO sample by summing the counts over the technical
replicates:

83
> y.all <- y.all[, SRA$SRA]
> y <- sumTechReps(y.all, ID=SRA$GEO)
> y$samples

group lib.size norm.factors


GSM461176 1 31007529 1
GSM461177 1 13040952 1
GSM461178 1 15030819 1
GSM461179 1 28143539 1
GSM461180 1 14901292 1
GSM461181 1 16264066 1

> colnames(y) <- c("N1","N3","N4","D1","D3","D4")

Annotation for D. melanogaster genes was downloaded from ftp://ftp.ncbi.nlm.nih.


gov/gene/DATA/GENE_INFO/Invertebrates. We now add selected annotation columns to the
DGEList object:

> ncbi.L1 <- readLines("Drosophila_melanogaster.gene_info", n = 1)


> ncbi.colname <- unlist(strsplit(substring(ncbi.L1, 10, 234), ))
> ncbi <- read.delim("Drosophila_melanogaster.gene_info", skip=1,
+ header=FALSE, stringsAsFactors=FALSE)
> colnames(ncbi) <- ncbi.colname
> m <- match(y$genes$GeneID, ncbi$GeneID)
> y$genes$Chr <- ncbi$chromosome[m]
> y$genes$Symbol <- ncbi$Symbol[m]
> y$genes$Strand <- NULL
> head(y$genes)

GeneID Chr Start End Length Symbol


138088 30970 X 138094 139379 1286 CG3038
138087 30970 X 139445 139611 167 CG3038
138089 30970 X 139445 139889 445 CG3038
138086 30970 X 139713 139889 177 CG3038
138091 30971 X 140011 141629 1619 G9a
138092 30971 X 142415 144271 1857 G9a

4.5.5 Filtering and normalization


Here, an exon is only retained if it is expressed at a count-per-million (CPM) above 1 in at
least 3 samples.

> keep <- rowSums(cpm(y) > 1) >=3


> summary(keep)

84
Mode FALSE TRUE NAs
logical 36926 37258 0

> y <- y[keep, , keep.lib.sizes=FALSE]

TMM normalization is performed to eliminate composition biases between libraries.

> y <- calcNormFactors(y)


> y$samples

group lib.size norm.factors


N1 1 30872843 0.955
N3 1 12962245 1.031
N4 1 14908555 0.976
D1 1 27989806 1.005
D3 1 14760887 1.022
D4 1 16172265 1.014

4.5.6 Data exploration


The data can be explored by generating multi-dimensional scaling (MDS) plots. This visu-
alizes the differences between the expression profiles of different samples in two dimensions.
> plotMDS(y)

The MDS plot shows clear separation of the Pasilla down vs normal samples, but also a
batch effect associated with sequencing type and date.

85
4.5.7 The design matrix
To account for the batch effect observed from the MDS plot, we create a design matrix as
follows:

> Batch <- factor(c(1,3,4,1,3,4))


> Pasilla <- factor(GEO$Pasilla, levels=c("Normal","Down"))
> design <- model.matrix(~ Batch + Pasilla)
> design

(Intercept) Batch3 Batch4 PasillaDown


1 1 0 0 0
2 1 1 0 0
3 1 0 1 0
4 1 0 0 1
5 1 1 0 1
6 1 0 1 1
attr(,"assign")
[1] 0 1 1 2
attr(,"contrasts")
attr(,"contrasts")$Batch
[1] "contr.treatment"

attr(,"contrasts")$Pasilla
[1] "contr.treatment"

4.5.8 Estimating the dispersion


We estimate NB dispersions using the estimateDisp function. The estimated dispersions
can be visualized with plotBCV.

> y <- estimateDisp(y, design, robust=TRUE)


> y$common.dispersion

[1] 0.0141

> plotBCV(y)

86
Note that only the trended dispersion is used under the quasi-likelihood (QL) pipeline. The
tagwise and common estimates are shown here but will not be used further.
For the QL dispersions, estimation can be performed using the glmQLFit function. The
results can be visualized with the plotQLDisp function.

> fit <- glmQLFit(y, design, robust=TRUE)


> plotQLDisp(fit)

87
4.5.9 Differential expression
We test for differentially expressed exons between Pasilla knockdown and normal using the
QL F-test.

> qlf <- glmQLFTest(fit, coef=4)

The top set of most significant exons can be examined with topTags. Here, a positive
log-fold change represents exons that are up in Pasilla knockdown over normal. Multiplicity
correction is performed by applying the Benjamini-Hochberg method on the p-values, to
control the false discovery rate (FDR).

> topTags(qlf)

Coefficient: PasillaDown
GeneID Chr Start End Length Symbol logFC logCPM F PValue FDR
150709 32007 X 10674926 10676128 1203 sesB -3.26 7.21 949 7.41e-15 1.39e-10
150713 32007 X 10675026 10676128 1103 sesB -3.26 7.21 948 7.46e-15 1.39e-10
150697 32008 X 10672987 10673728 742 Ant2 2.85 6.14 863 1.48e-14 1.84e-10
91614 42865 3R 19970915 19971592 678 Kal1 -4.43 3.81 756 3.88e-14 3.61e-10
107856 44030 3L 2561932 2562843 912 msn -2.46 5.59 615 1.74e-13 1.30e-09
150702 32008 X 10674230 10674694 465 Ant2 2.97 4.55 575 2.83e-13 1.33e-09
150695 32008 X 10674230 10674559 330 Ant2 2.96 4.55 574 2.86e-13 1.33e-09
70750 44258 3R 5271691 5272628 938 ps -2.27 5.95 572 2.97e-13 1.33e-09
11333 44548 2R 6407125 6408782 1658 lola 2.26 6.15 565 3.21e-13 1.33e-09
96433 43230 3R 22697648 22697717 70 BM-40-SPARC -2.17 6.65 542 4.37e-13 1.63e-09

The total number of DE exons in each direction at a FDR of 5% can be examined with
decideTests.

> is.de <- decideTests(qlf, p.value=0.05)


> summary(is.de)

PasillaDown
-1 2059
0 33385
1 1814

4.5.10 Alternative splicing


We detect alternative splicing by testing for differential exon usage between Pasilla knock-
down and normal in each gene.

88
> sp <- diffSpliceDGE(fit, coef=4, geneid="GeneID", exonid="Start")

Total number of exons: 37258


Total number of genes: 8192
Number of genes with 1 exon: 1619
Mean number of exons in a gene: 5
Max number of exons in a gene: 56

Two testing methods at the gene-level are provided. The Simes method is likely to be
more powerful when only a minority of the exons for a gene are differentially spliced. The
F-tests are likely to be powerful for genes in which several exons are differentially spliced.
The top spliced genes under the Simes method are shown below:

> topSpliceDGE(sp, test="Simes", n=20)

GeneID Chr Symbol NExons P.Value FDR


141235 45320 X trol 44 1.64e-30 1.08e-26
11214 44548 2R lola 30 4.28e-30 1.41e-26
95956 44448 3R scrib 35 1.10e-20 2.40e-17
107810 44030 3L msn 24 1.15e-18 1.89e-15
19880 36773 2R Dg 15 2.17e-18 2.86e-15
16060 36542 2R shot 38 2.03e-17 2.22e-14
82117 42130 3R osa 17 2.50e-17 2.35e-14
32242 37893 2R slik 19 2.59e-15 2.13e-12
131170 40205 3L CG42674 16 3.88e-15 2.84e-12
163416 32817 X CrebB-17A 12 1.00e-14 6.58e-12
150694 32008 X Ant2 5 1.02e-13 6.07e-11
110493 38491 3L ens 16 1.88e-13 1.03e-10
41795 3771968 2L Msp-300 33 2.80e-12 1.41e-09
115767 38879 3L pbl 12 3.84e-12 1.80e-09
2032 2768716 2R mim 25 8.98e-12 3.93e-09
526 35494 2R laccase2 9 2.81e-11 1.11e-08
150710 32007 X sesB 7 2.88e-11 1.11e-08
166094 33098 X CG32521 8 4.29e-11 1.57e-08
52823 34652 2L vir-1 7 8.31e-11 2.88e-08
85970 42428 3R Stat92E 14 4.41e-10 1.45e-07

The top spliced genes identified by F-tests are shown below:

> topSpliceDGE(sp, test="gene", n=20)

GeneID Chr Symbol NExons gene.F P.Value FDR


141235 45320 X trol 44 52.5 2.53e-51 1.66e-47
11214 44548 2R lola 30 42.7 6.84e-34 2.25e-30
41795 3771968 2L Msp-300 33 22.7 2.34e-27 5.13e-24
95956 44448 3R scrib 35 17.2 1.08e-24 1.78e-21
16060 36542 2R shot 38 11.1 6.90e-20 9.07e-17

89
32242 37893 2R slik 19 25.8 1.22e-18 1.34e-15
166094 33098 X CG32521 8 64.1 1.14e-14 1.07e-11
19880 36773 2R Dg 15 21.8 2.57e-14 2.11e-11
2032 2768716 2R mim 25 10.7 8.49e-14 6.20e-11
107810 44030 3L msn 24 10.6 3.12e-13 2.05e-10
150694 32008 X Ant2 5 108.1 4.05e-13 2.36e-10
82117 42130 3R osa 17 15.6 4.30e-13 2.36e-10
163416 32817 X CrebB-17A 12 22.3 2.49e-12 1.26e-09
150710 32007 X sesB 7 51.5 5.26e-12 2.47e-09
131170 40205 3L CG42674 16 12.7 4.91e-11 2.15e-08
115767 38879 3L pbl 12 15.8 2.81e-10 1.16e-07
134207 40464 3L Ten-m 12 15.6 3.49e-10 1.35e-07
11103 36104 2R G-oalpha47A 13 14.1 3.87e-10 1.41e-07
108973 38376 3L BtbVII 10 18.7 5.84e-10 2.02e-07
110493 38491 3L ens 16 10.6 7.63e-10 2.51e-07

We plot all the exons for the top two most differentially spliced genes. Exons that are
individually significant are highlighted.

> par(mfrow=c(1,2))
> plotSpliceDGE(sp, geneid="trol", genecol="Symbol")
> plotSpliceDGE(sp, geneid="lola", genecol="Symbol")

We can see that a block of five or six exons at the right end of the trol gene are relatively
lost when Pasilla is down. Most exons in the first half of the gene behave similarly to each
other. This gene is on the negative strand, so transcription is from right to left. The gene
trol was identified by Brooks et al [3] to have a novel set of coordinately regulated exons.

90
4.5.11 Setup
This analysis was conducted on:

> sessionInfo()

R version 3.3.3 (2017-03-06)


Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 7 x64 (build 7601) Service Pack 1

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC_MONETARY=English_Australia.1252 LC_NUMERIC=C
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] parallel stats4 stats graphics grDevices utils datasets methods base

other attached packages:


[1] GO.db_3.4.0 org.Mm.eg.db_3.4.0 tweeDEseqCountData_1.12.0
[4] NBPSeq_0.3.0 org.Hs.eg.db_3.4.0 AnnotationDbi_1.36.2
[7] IRanges_2.8.2 S4Vectors_0.12.2 Biobase_2.34.0
[10] BiocGenerics_0.20.0 edgeR_3.17.9 limma_3.30.13

loaded via a namespace (and not attached):


[1] Rcpp_0.12.10 magrittr_1.5 splines_3.3.3 munsell_0.4.3 statmod_1.4.29
[6] colorspace_1.3-2 lattice_0.20-34 stringr_1.2.0 plyr_1.8.4 tools_3.3.3
[11] grid_3.3.3 gtable_0.2.0 DBI_0.6 assertthat_0.1 lazyeval_0.2.0
[16] digest_0.6.12 tibble_1.2 reshape2_1.4.2 ggplot2_2.2.1 memoise_1.0.0
[21] qvalue_2.6.0 RSQLite_1.1-2 stringi_1.1.2 scales_0.4.1 locfit_1.5-9.1

4.5.12 Acknowledgements
Thanks to Yang Liao for mapping the reads and running featureCounts and Yifang Hu for
the initial analysis of the data.

4.6 CRISPR-Cas9 knockout screen analysis


4.6.1 Introduction
Dai et al. (2014) [7] describe the use of edgeR to analyze data from pooled genetic screens
utilizing either shRNAs or CRISPR-Cas9 to disrupt gene expression in a population of cells.
In this case study we analyze data from a pooled screen that uses CRISPR-Cas9 (clus-
tered regularly interspaced short palindromic repeats-associated nuclease Cas9) knockout

91
technology. In this example, a library of around 64,000 sgRNAs (as used in Shalem et al.
2014 [29]) were screened to look for genes that may lead to resistance from a particular drug.
This unpublished data set has been anonymised.

4.6.2 Sequence processing


Multiple single guide RNAs (sgRNAs) per gene (generally between 3-6) were included in the
screen. Below we read in the raw sequences from the paired end fastq files screen4 R1.fastq
and screen4 R2.fastq using the processAmplicons function in edgeR. This screen employed
a dual indexing strategy where the first 8 bases from each pair of reads contained an index
sequence that uniquely identifies which sample a particular sgRNA sequence originated from.
Matches between sample indexes and sgRNAs listed in the files Samples4.txt and sgRNAs4.txt
are identified by processAmplicons to produce a DGEList of counts.

> # Read in sample & sgRNA information


> sampleanno <- read.table("Samples4.txt", header=TRUE, sep="\t")
> sampleanno[1:5,]
> sgseqs <- read.table("sgRNAs4.txt", header=TRUE, sep="\t")
> sgseqs[1:5,]
> # Process raw sequences from fastq files
> x <- processAmplicons("screen4_R1.fastq", readfile2="screen4_R2.fastq",
+ barcodefile="Samples4.txt", hairpinfile="sgRNAs4.txt",
+ barcodeStart=1, barcodeEnd=8, hairpinStart=33, hairpinEnd=52,
+ barcodeStartRev=1, barcodeEndRev=8, verbose=TRUE)

Note that this dual indexing strategy requires an additional column named Sequences-
Rev in the file that contains the sample annotation information. Also, readFile2 must
be specified, along with position information (barcodeStartRev, barcodeEndRev) for the
second index in the second read from each pair (in this case the index can be found in the
first 8 bases).

4.6.3 Filtering and data exploration


We next filter out sgRNAs and samples with low numbers of reads.

> x

An object of class "DGEList"


$counts
A1_1_1 A2_1_2 A3_1_3 A4_1_4 A5_1_5 A6_1_6 A7_2_1 A8_2_2 A9_2_3 A10_2_4 A11_2_5 A12_2_6
sgRNA1 0 14 0 0 3 36 1 55 0 23 0 62
sgRNA2 0 18 0 0 1 22 0 26 0 29 0 43
sgRNA3 0 50 0 0 4 52 1 98 0 60 0 111

92
sgRNA4 0 32 0 0 3 55 2 54 0 51 0 57
sgRNA5 0 7 0 0 1 3 0 3 0 5 1 5
A13_3_1 A14_3_2 A15_3_3 A16_3_4 A17_3_5 A18_3_6 A19_4_1 A20_4_2 A21_4_3 A22_4_4 A23_4_5
sgRNA1 0 21 0 30 21 36 0 37 0 39 1
sgRNA2 0 27 0 27 26 30 1 23 0 44 0
sgRNA3 0 59 0 62 24 63 0 44 0 106 0
sgRNA4 0 43 0 50 19 26 0 44 0 94 0
sgRNA5 0 3 0 3 1 7 0 1 0 8 0
A24_4_6 B1_5_1 B2_5_2 B3_5_3 B4_5_4 B5_5_5 B6_5_6 B7_6_1 B8_6_2 B9_6_3 B10_6_4 B11_6_5
sgRNA1 63 3 5 5 26 11 4 3 4 14 3 8
sgRNA2 34 14 27 16 77 22 42 9 24 12 27 15
sgRNA3 70 16 39 27 53 41 43 31 24 14 35 43
sgRNA4 107 15 13 12 24 12 22 10 10 11 20 15
sgRNA5 3 0 5 12 15 6 25 6 9 6 3 9
B12_6_6 B13_7_1 B14_7_2 B15_7_3 B16_7_4 B17_7_5 B18_7_6 B19_8_1 B20_8_2 B21_8_3 B22_8_4
sgRNA1 6 9 10 6 8 11 31 6 13 9 25
sgRNA2 41 11 23 14 64 46 66 18 31 12 94
sgRNA3 45 38 51 14 59 38 73 31 29 31 63
sgRNA4 18 13 12 7 28 15 23 14 18 19 27
sgRNA5 16 1 5 0 3 7 11 1 7 3 18
B23_8_5 B24_8_6 A1_1_7 A2_1_8 A3_1_9 A7_2_7 A8_2_8 A9_2_9 A13_3_7 A14_3_8 A15_3_9 A19_4_7
sgRNA1 13 19 0 18 0 0 38 0 0 16 0 0
sgRNA2 36 64 0 12 0 0 18 0 0 15 0 0
sgRNA3 58 74 0 30 0 4 71 0 0 32 0 1
sgRNA4 19 36 0 27 0 1 39 0 0 34 0 1
sgRNA5 24 12 0 2 0 0 2 0 0 8 0 0
A20_4_8 A21_4_9 B1_5_7 B2_5_8 B3_5_9 B7_6_7 B8_6_8 B9_6_9 B13_7_7 B14_7_8 B15_7_9 B19_8_7
sgRNA1 32 0 5 6 5 10 5 15 2 9 3 10
sgRNA2 16 0 9 20 8 11 22 7 7 22 16 20
sgRNA3 39 0 10 19 23 19 14 30 30 35 24 27
sgRNA4 28 0 8 9 9 8 10 5 11 9 8 11
sgRNA5 0 0 0 9 4 4 10 3 2 2 0 3
B20_8_8 B21_8_9
sgRNA1 15 8
sgRNA2 20 9
sgRNA3 18 17
sgRNA4 12 11
sgRNA5 10 8
64746 more rows ...

$samples
ID lib.size norm.factors SequencesReverse group Infection Replicate IndexF IndexR
1 A1_1_1 188 1 TAAGGCGA Drug 1 1 1 1
2 A2_1_2 667530 1 CGTACTAG NoDrug 1 1 1 2
3 A3_1_3 1340 1 AGGCAGAA Drug 1 1 1 3
4 A4_1_4 2473 1 TCCTGAGC NoDrug 1 1 1 4
5 A5_1_5 69161 1 GGACTCCT Drug 1 1 1 5
67 more rows ...

93
$genes
ID Sequences Gene
1 sgRNA1 TACCCTGGGACTGTACCCCC 99
2 sgRNA2 ACCCTTGCTGCACGACCTGC 99
3 sgRNA3 TCGCTCGCCCCGCTCTTCCT 99
4 sgRNA4 TGACGCCTCGGACGTGTCTG 19
5 sgRNA5 CGTCATAGCCAATCTTCTTC 19
64746 more rows ...

> table(x$samples$group)

Drug NoDrug
40 32

> # Filter sgRNAs and samples with low counts


> # Need a CPM greater than 5 in 15 or more samples to keep sgRNAs
> selr <- rowSums(cpm(x$counts)>5)>=15
> # Need at least 100,000 reads to keep a given sample
> selc <- colSums(x$counts)>=100000
> x <- x[selr,selc]
> # Set up drug treatment colours
> cols <- as.numeric(x$samples$group)+2
> # Plot number of sgRNAs that could be matched per sample
> # and total for each sgRNA across all samples
> par(mfrow=c(2,1))
> barplot(colSums(x$counts), las=2, main="Counts per index", col=cols, cex.names=0.5, cex.axis=0.8)
> legend("topright", legend=c("Control", "Drug"), col=c(3,4), pch=15)
> barplot(rowSums(x$counts), las=2, main="Counts per sgRNA", axisnames=FALSE, cex.axis=0.8)

94
A multidimensional scaling plot was generated to assess the consistency between replicate
samples. There is a clear separation between the two infections, indicating the need to
incorporate an effect for this in the GLM.

> # Make an MDS plot to visualise relationships between replicate samples


> # Set up infection colours
> cols2 <- x$samples$Infection
> par(mfrow=c(1,2))
> plotMDS(x, col=cols, main="MDS Plot: drug treatment colours")
> legend("topleft", legend=c("Control", "Drug"), col=c(3,4), pch=15)
> plotMDS(x, col=cols2, main="MDS Plot: infection colours")
> legend("topleft", legend=c("Inf#1", "Inf#2"), col=c(1,2), pch=15)

4.6.4 The design matrix and dispersion estimation


A design matrix is set up for the GLM analysis, and the sgRNA-specific variation is estimated
and plotted (while taking into account both drug treatment and infection number).

> # Set up design matrix for GLM


> treatment <- relevel(as.factor(x$samples$group), "NoDrug")
> infection <- as.factor(x$samples$Infection)
> des <- model.matrix(~treatment+infection)
> des[1:5,]

95
(Intercept) treatmentDrug infection2
1 1 0 0
2 1 0 0
3 1 0 0
4 1 0 0
5 1 0 0

> colnames(des)[2:3] <- c("Drug", "Infection2")


> # Estimate dispersions
> xglm <- estimateDisp(x, des)
> sqrt(xglm$common.disp)

[1] 0.258

> # Plot BCVs versus abundance


> plotBCV(xglm, main="BCV Plot")

4.6.5 Differential representation analysis


We use the function glmFit to fit the sgRNA-specific models and glmLRT to do the testing
between the drug treated and control samples. The top ranked sgRNAs are listed using the
topTags function and sgRNAs with FDR < 0.0001 [2] and log-fold-change 1 are highlighted
on a plot of log-fold-change versus log-counts-per-millions by the plotSmear function. Since
this is a positive screen, we highlight over-represented sgRNAs (i.e. those with positive log-
fold-changes) since the model is parameterized to compare drug treatment versus control
(coefficient 2 in the design matrix).

96
> # Fit negative bionomial GLM
> fit <- glmFit(xglm, des)
> # Carry out Likelihood ratio test
> lrt <- glmLRT(fit, coef=2)
> # Show top ranked sgRNAs
> topTags(lrt)

Coefficient: Drug
ID Sequences Gene logFC logCPM LR PValue FDR
816 sgRNA816 TCCGAACTCCCCCTTCCCGA 269 4.36 7.32 699 4.54e-154 2.56e-149
4070 sgRNA4070 GTTGTGCTCAGTACTGACTT 1252 2.94 8.00 659 2.14e-145 6.04e-141
6351 sgRNA6351 AAAAACGTATCTATTTTTAC 1957 3.37 6.34 422 8.56e-94 1.61e-89
12880 sgRNA12880 CTGCACCGAAGAGAGCTGCT 3979 2.83 7.04 322 5.45e-72 7.68e-68
23015 sgRNA23015 CAATTTGATCTCTTCTACTG 6714 3.16 4.83 233 1.35e-52 1.52e-48
62532 sgRNA62532 AAACACGTCCAGTGCAGCCC 19612 2.79 4.91 216 6.18e-49 5.81e-45
38819 sgRNA38819 TACGTTGTCGGGCGCCGCCA 11531 2.42 6.54 204 2.96e-46 2.38e-42
3887 sgRNA3887 AACGCTGGACTCGAATGGCC 1194 2.28 5.33 203 4.05e-46 2.85e-42
19299 sgRNA19299 GGGGTCTTACCCGAGGCTCC 5732 1.94 5.63 202 7.67e-46 4.80e-42
52924 sgRNA52924 CCACCGCGTTCCACTTCTTG 16395 2.87 6.64 193 5.54e-44 3.12e-40

> # Select sgRNAs with FDR < 0.0001 and logFC <= -1 to highlight on plot
> thresh <- 0.0001
> lfc <- 1
> top4 <- topTags(lrt, n=Inf)
> top4ids <- top4$table[top4$table$FDR<thresh & top4$table$logFC>=lfc,1]
> # Plot logFC versus logCPM
> plotSmear(lrt, de.tags=top4ids, pch=20, cex=0.6, main="Drug treatment vs Control")
> abline(h = c(-1, 0, 1), col = c("dodgerblue", "yellow", "dodgerblue"), lty=2)

97
4.6.6 Gene set tests to summarize over multiple sgRNAs targeting
the same gene
We finish this analysis by summarising data across multiple sgRNAs that target the same
gene in order to get a gene-by-gene ranking, rather than a sgRNA-specific one. The camera
gene-set test [34] is used for this purpose. For this analysis, the collection of sgRNAs that
target a specific gene can be regarded as a set. In the code below, we restrict our analysis to
genes with more than 3 sgRNAs. A barcode plot, highlighting the rank of sgRNAs for a given
gene relative to the entire data set is generated for the top-ranked gene (11531). Abundance
of sgRNAs targeting this gene tend to increase with drug treatment (FDR=0.0003).

> # Carry out camera gene-set analysis


> genesymbols <- x$genes[,3]
> genesymbollist <- list()
> unq <- unique(genesymbols)
> unq <- unq[!is.na(unq)]
> for(i in unq) {
+ sel <- genesymbols==i & !is.na(genesymbols)
+ if(sum(sel)>3)
+ genesymbollist[[i]] <- which(sel)
+ }
> # Run camera for all genes
> camera.res <- camera(xglm, index=genesymbollist, des, contrast=2)
> # Display results for top ranked genes
> camera.res[1:10,]

NGenes Direction PValue FDR


19612 5 Up 1.44e-08 7.92e-05
8808 4 Up 9.36e-06 2.33e-02
3979 4 Up 1.34e-05 2.33e-02
8370 4 Up 1.69e-05 2.33e-02
11531 4 Up 2.33e-05 2.57e-02
10386 4 Up 1.40e-04 1.14e-01
2005 4 Up 1.45e-04 1.14e-01
4086 4 Up 1.95e-04 1.34e-01
10784 4 Up 2.26e-04 1.38e-01
11412 5 Up 6.93e-04 3.82e-01

> # Make a barcode plot for an example that ranks highly


> # Gene 11531
> barcodeplot(lrt$table$logFC,index=genesymbollist[[11531]],
+ main="Barcodeplot for Gene 11531",
+ labels=c("Positive logFC", "Negative logFC"),
+ quantile=c(-0.5,0.5))

98
The raw data from this example and several other case studies for this technology can
be found at http://bioinf.wehi.edu.au/shRNAseq/.

4.6.7 Setup
This analysis was conducted on:

> sessionInfo()

R version 3.3.3 (2017-03-06)


Platform: x86_64-w64-mingw32/x64 (64-bit)
Running under: Windows 7 x64 (build 7601) Service Pack 1

locale:
[1] LC_COLLATE=English_Australia.1252 LC_CTYPE=English_Australia.1252
[3] LC_MONETARY=English_Australia.1252 LC_NUMERIC=C
[5] LC_TIME=English_Australia.1252

attached base packages:


[1] parallel stats4 stats graphics grDevices utils datasets methods base

other attached packages:


[1] GO.db_3.4.0 org.Mm.eg.db_3.4.0 tweeDEseqCountData_1.12.0
[4] NBPSeq_0.3.0 org.Hs.eg.db_3.4.0 AnnotationDbi_1.36.2
[7] IRanges_2.8.2 S4Vectors_0.12.2 Biobase_2.34.0
[10] BiocGenerics_0.20.0 edgeR_3.17.9 limma_3.30.13

loaded via a namespace (and not attached):


[1] Rcpp_0.12.10 magrittr_1.5 splines_3.3.3 munsell_0.4.3 statmod_1.4.29
[6] colorspace_1.3-2 lattice_0.20-34 stringr_1.2.0 plyr_1.8.4 tools_3.3.3
[11] grid_3.3.3 gtable_0.2.0 DBI_0.6 assertthat_0.1 lazyeval_0.2.0

99
[16] digest_0.6.12 tibble_1.2 reshape2_1.4.2 ggplot2_2.2.1 memoise_1.0.0
[21] qvalue_2.6.0 RSQLite_1.1-2 stringi_1.1.2 scales_0.4.1 locfit_1.5-9.1

4.6.8 Acknowledgements
Thanks to Dr Sam Wormald from the WEHI for providing the data set used in this case
study.

100
Bibliography

1. Anders, S., McCarthy, D.J., Chen, Y., Okoniewski, M., Smyth, G.K., Huber, W., and
Robinson, M.D. (2013). Count-based differential expression analysis of RNA sequencing
data using R and Bioconductor. Nature Protocols 8, 17651786.

2. Benjamini, Y. and Hochberg, Y. (1995). Controlling the false discovery rate: a practical
and powerful approach to multiple testing. Journal of the Royal Statistical Society Series
B 57, 289300.

3. Brooks, A.N., Yang, L., Duff, M.O., Hansen, K.D., Park, J.W., Dudoit, S., Brenner, S.E.,
and Graveley, B.R. (2011). Conservation of an RNA regulatory map between Drosophila
and mammals. Genome Res 21, 193202.

4. Bullard, J.H., Purdom, E., Hansen, K.D., and Dudoit, S. (2010). Evaluation of statistical
methods for normalization and differential expression in mRNA-Seq experiments. BMC
Bioinformatics 18, 1194.

5. Chen, Y., Lun, A.T.L., and Smyth, G.K. (2014). Differential expression analysis of
complex RNA-seq experiments using edgeR. In S. Datta and D.S. Nettleton, editors,
Statistical Analysis of Next Generation Sequence Data, pages 5174. Springer, New York.

6. Cumbie, J.S., Kimbrel, J.A., Di, Y., Schafer, D.W., Wilhelm, L.J., Fox, S.E., Sullivan,
C.M., Curzon, A.D., Carrington, J.C., Mockler, T.C., and Chang, J.H. (2011). Gene-
counter: A computational pipeline for the analysis of RNA-Seq data for gene expression
differences. PLoS ONE 6, e25279.

7. Dai, Z., Sheridan, J.M., Gearing, L.J., Moore, D.L., Su, S., Wormald, S., Wilcox, S.,
OConnor, L., Dickins, R.A., Blewitt, M.E., and Ritchie, M.E. (2014). edgeR: a versatile
tool for the analysis of shRNA-seq and CRISPR-Cas9 genetic screens. F1000Res 3, 95.

8. Fu, N.Y., Rios, A., Pal, B., Soetanto, R., Lun, A.T.L., Liu, K., Beck, T., Best, S.,
Vaillant, F., Bouillet, P., Strasser, A., Preiss, T., Smyth, G.K., Lindeman, G., , and
Visvader, J. (2015). EGF-mediated induction of Mcl-1 at the switch to lactation is
essential for alveolar cell survival. Nature Cell Biology 17, 365375.

101
9. Hansen, K.D., Irizarry, R.A., and Zhijin, W. (2012). Removing technical variability in
RNA-seq data using conditional quantile normalization. Biostatistics 13, 204216.

10. International HapMap Consortium, T. (2005). A haplotype map of the human genome.
Nature 437, 12991320.

11. Liao, Y., Smyth, G.K., and Shi, W. (2013). The Subread aligner: fast, accurate and
scalable read mapping by seed-and-vote. Nucleic Acids Research 41, e108.

12. Liao, Y., Smyth, G.K., and Shi, W. (2014). featureCounts: an efficient general-purpose
read summarization program. Bioinformatics 30, 923930.

13. Lu, J., Tomfohr, J., and Kepler, T. (2005). Identifying differential expression in multiple
SAGE libraries: an overdispersed log-linear model approach. BMC Bioinformatics 6,
165.

14. Lun, A.T.L., Chen, Y., and Smyth, G.K. (2016). Its DE-licious: a recipe for differential
expression analyses of RNA-seq experiments using quasi-likelihood methods in edgeR.
Methods in Molecular Biology 1418, 391416.

15. Lund, S., Nettleton, D., McCarthy, D., and Smyth, G. (2012). Detecting differential
expression in RNA-sequence data using quasi-likelihood with shrunken dispersion esti-
mates. Statistical Applications in Genetics and Molecular Biology 11, Article 8.

16. Marioni, J.C., Mason, C.E., Mane, S.M., Stephens, M., and Gilad, Y. (2008). RNA-seq:
An assessment of technical reproducibility and comparison with gene expression arrays.
Genome Res 18, 15091517.

17. McCarthy, D.J., Chen, Y., and Smyth, G.K. (2012). Differential expression analysis of
multifactor RNA-Seq experiments with respect to biological variation. Nucleic Acids
Research 40, 42884297.

18. McCarthy, D.J. and Smyth, G.K. (2009). Testing significance relative to a fold-change
threshold is a TREAT. Bioinformatics 25, 765771.

19. McCullagh, P. and Nelder, J.A. (1989). Generalized Linear Models. Chapman &
Hall/CRC, Boca Raton, Florida, 2nd edition.

20. Nelder, J.A. and Wedderburn, R.W.M. (1972). Generalized linear models. Journal of
the Royal Statistical Society Series A (General) 135, 370384.

21. Phipson, B., Lee, S., Majewski, I.J., Alexander, W.S., and Smyth, G.K. (2016).
Robust hyperparameter estimation protects against hypervariable genes and im-
proves power to detect differential expression. Annals of Applied Statistics 10,
http://arxiv.org/abs/1602.08678.

102
22. Pickrell, J.K., Marioni, J.C., Pai, A.A., Degner, J.F., Engelhardt, B.E., Nkadori, E.,
Veyrieras, J.B., Stephens, M., Gilad, Y., and Pritchard, J.K. (2010). Understanding
mechanisms underlying human gene expression variation with RNA sequencing. Nature
464, 768772.
23. Pickrell, J.K., Pai, A.A., Gilad, Y., and Pritchard, J.K. (2010). Noisy splicing drives
mRNA isoform diversity in human cells. PLoS Genetics 6, e1001236.
24. Risso, D., Schwartz, K., Sherlock, G., and Dudoit, S. (2011). GC-content normalization
for RNA-Seq data. BMC Bioinformatics 12, 480.
25. Robinson, M., McCarthy, D., and Smyth, G. (2010). edgeR: a Bioconductor package
for differential expression analysis of digital gene expression data. Bioinformatics 26,
139140.
26. Robinson, M.D. and Oshlack, A. (2010). A scaling normalization method for differential
expression analysis of RNA-seq data. Genome Biology 11, R25.
27. Robinson, M.D. and Smyth, G.K. (2007). Moderated statistical tests for assessing dif-
ferences in tag abundance. Bioinformatics 23, 28812887.
28. Robinson, M.D. and Smyth, G.K. (2008). Small-sample estimation of negative binomial
dispersion, with applications to SAGE data. Biostatistics 9, 321332.
29. Shalem, O., Sanjana, N.E., Hartenian, E., Shi, X., Scott, D.A., Mikkelsen, T.S., Heckl,
D., Ebert, B.L., Root, D.E., Doench, J.G., and Zhang, F. (2014). Genome-scale CRISPR-
Cas9 knockout screening in human cells. Science 343, 847.
30. Smyth, G. (2004). Linear models and empirical Bayes methods for assessing differential
expression in microarray experiments. Statistical Applications in Genetics and Molecular
Biology 3, Article 3.
31. Subramanian, A., Tamayo, P., Mootha, V.K., Mukherjee, S., Ebert, B.L., Gillette, M.A.,
Paulovich, A., Pomeroy, S.L., Golub, T.R., Lander, E.S., and Mesirov, J.P. (2005).
Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide
expression profiles. Proc Natl Acad Sci USA 102, 1554550.
32. Tuch, B.B., Laborde, R.R., Xu, X., Gu, J., Chung, C.B., Monighetti, C.K., Stanley, S.J.,
Olsen, K.D., Kasperbauer, J.L., Moore, E.J., Broomer, A.J., Tan, R., Brzoska, P.M.,
Muller, M.W., Siddiqui, A.S., Asmann, Y.W., Sun, Y., Kuersten, S., Barker, M.A.,
Vega, F.M.D.L., and Smith, D.I. (2010). Tumor transcriptome sequencing reveals allelic
expression imbalances associated with copy number alterations. PLoS ONE 5, e9317.
33. Wu, D., Lim, E., Vaillant, F., Asselin-Labat, M., Visvader, J., and Smyth, G. (2010).
ROAST: rotation gene set tests for complex microarray experiments. Bioinformatics 26,
21762182.

103
34. Wu, D. and Smyth, G. (2012). Camera: a competitive gene set test accounting for
inter-gene correlation. Nucleic Acids Research 40, e133.

104

You might also like